34 results about "Somatic cell nuclear transfer" patented technology

The application discloses an embryo culture method and embryo culture solution for improving the quality of pig somatic cell nuclear transfer embryos, wherein a small molecule substance X1 capable of specifically combining with the RepA domain of Xist is added into a pig early embryo culture solution, so as to improve the development quality of pig SCNT embryos.

The application discloses a gene editing system for constructing a three-gene (GHR gene, IGF1 gene and IGF2 gene) combined mutation small pig nuclear transfer donor cell and application thereof. The application provides a kit comprising GHR-E5-gRNA2 shown in SEQ ID NO: 36, GHR-E5-gRNA3 shown in SEQ ID NO: 37, IGF1-E4-gRNA1 shown in SEQ ID NO: 38, IGF1-E4-gRNA2 shown in SEQ ID NO: 39, IGF2-E4-gRNA2 shown in SEQ ID NO: 40, IGF2-E4-gRNA7 shown in SEQ ID NO: 41 and NCN protein. The NCN protein is a Cas9 protein or a fusion protein with the Cas9 protein. The application adopts CRISPR / Cas9 technology combined with double gRNA editing to perform combined knockout of the GHR gene, the IGF1 gene and the IGF2 gene, and obtains a single cell clone with three-gene combined knockout, thereby laying a foundation for breeding small pigs and growth and development disorder or retardation model pigs through somatic cell nuclear transfer animal cloning technology in the later stage.

The invention relates to the technical field of animal breeding, in particular to a method for breeding black sheep. The method comprises the following steps: introducing an expression cassette into a cell to obtain a transgenic cell; and carrying out somatic cell nuclear transplantation cloning by adopting the transgenic cells to obtain the black sheep. The expression cassette comprises an intron of PK5 and beta-globin, and an EDN3 gene, the PK5 comprises a nucleotide sequence as shown in SEQ ID NO. 2; and the EDN3 gene comprises a nucleotide sequence as shown in SEQ ID NO. 4. A specific expression cassette and a carrier are researched, the black sheep of which the skin, hair, tongue, oral mucosa, eye white mucosa, epididymis and ears all become black can be prepared through somatic cell cloning on the basis of cells edited by the carrier, and important application value and economic value are achieved.

This invention discloses a gene editing system for constructing a porcine nuclear transplantation donor cell model of atherosclerosis with double gene mutations in AF and its applications. The invention provides a kit comprising plasmid pKG-U6gRNA (APOE-E2-gRNA2), a target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 25 (FBN1-gRNA4), a target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 26 (FBN1-gRNA6), and FBN1-mutant-ss163 as shown in SEQ ID NO: 27. The kit is used for: preparing recombinant cells; preparing porcine atherosclerosis models; preparing atherosclerosis cell models, atherosclerosis tissue models, or atherosclerosis organ models. The plasmid pKG-U6gRNA (APOE-E2-gRNA2) is transcribed to obtain sgRNA with a target sequence binding region as shown in nucleotides 1-20 of SEQ ID NO: 11. APOE‑E2‑gRNA2 This invention lays the foundation for developing pig models of atherosclerosis through somatic cell nuclear transfer animal cloning technology.

The invention discloses a culture solution for improving the development rate of in-vitro cultured pig blastocysts as well as application and a use method of the culture solution, and belongs to the technical field of livestock embryo engineering. The invention discloses a culture solution for improving the development rate of in-vitro cultured pig blastocysts, which is characterized in that a PZM3 culture solution is used as a basic culture solution, and 5-25ng / mL of tumor necrosis factor superfamily cell factor TNFSF12 is added. According to the present invention, the pig embryo needs to be subjected to in-vitro culture for 4 days in the TNFSF12-free basic culture solution, and then is transferred to the TNFSF12-containing basic culture solution so as to be continuously cultured for 2 days, such that the generation efficiency of the pig blastocyst can be effectively improved, and the support is provided for the application of the pig in-vitro fertilization, the somatic cell nuclear transfer, the embryo genome selection and other embryo engineering technologies in the agricultural breeding and the human medicine;

This invention discloses a gene editing system for constructing porcine nuclear transplantation donor cells for ALS models with SOD1 gene mutations and its applications. This invention also provides a method for preparing recombinant cells: SOD1- g RNA1 (target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 18), SOD1- g RNA6 (target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 19), SOD1-mutant-ss160 (shown in SEQ ID NO: 20), and NCN protein (Cas9 protein or a fusion protein containing Cas9 protein) were co-transfected into porcine cells to obtain recombinant cells. This invention utilizes CRISPR / Cas9 technology combined with ssODN homologous recombination technology to perform point mutation gene editing of the SOD1 gene, mimicking the natural pathogenesis and genetic characteristics of ALS, and obtaining single-cell clones with precise point mutations in the SOD1 gene. This lays the foundation for later breeding of ALS disease model pigs using somatic cell nuclear transfer animal cloning technology.

The invention belongs to the technical field of nucleus visual identification, and discloses a method for identifying and predicting the nucleus position of an oocyte by using a computer image, which comprises the following steps of: dividing the oocyte into a mature oocyte and an immature oocyte, and acquiring an oocyte image; dividing the oocyte image into a mature oocyte image and an immature oocyte image; carrying out visual imaging operation on the nucleus of the oocyte, and meanwhile, carrying out image annotation on an oocyte photo; performing data amplification on images containing mature oocytes and cell nucleus positions, and dividing the images into a training set and a verification set; a computer vision framework is trained using the data set. According to the method disclosed by the invention, the cell nucleus position of the mammal oocyte is predicted by utilizing a computer visual identification technology, the enucleation accuracy is improved from 53.84% to 92.30%, and the accuracy of judging the cell nucleus position of the oocyte in a somatic cell nucleus transplantation process is improved.

This invention relates to the fields of gene editing and animal genetic breeding technology, and discloses a precise editing method for key genes regulating lipid metabolism in cattle and sheep. The method includes: constructing a comprehensive lipid metabolism network map integrating transcriptomic, proteomic, and metabolomic data; using a graph neural network to identify key node genes with high flow weights and their negative feedback pathways; simulating cascade reactions after gene perturbation to assess compensatory effects; screening for multi-gene combinations that do not induce significant compensation and can synergistically regulate fat deposition and muscle growth; designing expression vectors containing multiple guide RNA sequences to achieve simultaneous and precise editing; and obtaining edited individuals and validating the phenotype through embryonic or somatic cell nuclear transfer. This invention, through system-level multi-target synergistic editing, avoids metabolic imbalances, improves editing effectiveness, and promotes muscle development while reducing fat deposition, providing a safe and efficient technical path for precision breeding of cattle and sheep.

This invention discloses a CRISPR system for constructing pig nuclear transfer donor cells for cataract models with YAP1 gene mutations and its applications. The invention provides the application of YAP1-gRNA2 (SEQ ID NO: 18), YAP1-gRNA3 (SEQ ID NO: 19), and NCN protein in a preparation kit; the kit is used for: preparing recombinant cells; preparing pig cataract models; preparing cataract cell models, cataract tissue models, or cataract organ models. This invention uses CRISPR / Cas9 technology combined with dual gRNA editing to knock out the YAP1 gene, simulating the natural pathogenesis and genetic characteristics of cataracts, and obtaining single-cell clones with the YAP1 gene knockout, laying the foundation for later breeding pig cataract models through somatic cell nuclear transfer animal cloning technology. This invention has significant application value for the development of cataract drugs and elucidating the pathogenesis of this disease.

The invention discloses a method for improving pig somatic cell nucleus embryo transfer efficiency, and belongs to the technical field of pig somatic cell nucleus transfer. The method comprises the following steps: treating a reconstructed embryo subjected to pig somatic cell nuclear transfer by using sodium butyrate to improve the acetylation level of the reconstructed embryo, or overexpressing KDM2A to reduce the methylation level of the reconstructed embryo so as to improve the efficiency of transferring the embryo by using the pig somatic cell nuclear transfer. According to the present invention, the research results show that the high enrichment of the ZGA gene promoter region H3K36me2 and the enrichment reduction of the far-end cis-regulatory element H3K27ac result in the existing unrepresented epigenetic disorder, such that the SCNT efficiency is limited; therefore, the H3K36me2 is deleted through the demethylase KDM2A, or the HDAC for inhibiting the deacetylation of the H3K27ac in a NaB-mediated manner is used, so that the development arrest of the SCNT embryo is relieved, and the blastocyst forming efficiency is improved.

The present application relates to the field of embryo engineering, and particularly relates to application of mangiferin in promoting maturation of animal oocytes. The present application discloses that mangiferin can promote maturation of animal oocytes, especially maturation of pig oocytes; can improve in-vitro maturation efficiency of oocytes; can reduce the apoptosis rate of oocytes and improve the subsequent development potential of oocytes. Mangiferin can be used to promote in-vitro maturation of oocytes, and can be used to prepare or directly serve as a drug for improving in-vitro maturation and development of oocytes, thereby opening up a new application direction for mangiferin. The present application uses mangiferin to improve in-vitro maturation efficiency of oocytes, solves the problems of low maturation efficiency and long culture period, and provides more high-quality oocytes for somatic cell nuclear transfer, in-vitro fertilization and transgenic cloning by using the technical scheme of mangiferin in the present application, thereby having a wide application prospect in actual production.

The invention discloses a marker for evaluating the development potential of a pig somatic cell nuclear transfer embryo and application, and belongs to the technical field of development of the pig somatic cell nuclear transfer embryo. According to the invention, the endogenous retrovirus MLT2B2 is determined to be used as a functional regulator and a biomarker of the porcine embryo ZGA. The expression of the MLT2B2 in a 4-cell-stage SCNT embryo has obvious heterogeneity, and the embryo of the MLT2B2-generally shows ZGA retardation and low developmental potential. Single-embryo multi-omics analysis and pedigree tracking prove that the activation of the MLT2B2 in a 4-cell stage can be used as a predictive factor of the developmental ability of the SCNT embryo, that is, the MLT2B2 + embryo has recovered chromatin accessibility and transcription fidelity.

The invention discloses a method for improving the developmental capacity of a pig somatic cell nuclear transfer embryo and application, and belongs to the technical field of embryo culture. The invention aims to improve the success rate of pig somatic cell nucleus embryo transfer. The invention provides a method for improving the ex-embryonic developmental capacity of pig somatic cell nuclear transfer, which comprises the following steps: adding a small molecule inhibitor into a somatic cell culture solution used for somatic cell nuclear transfer to reduce somatic cell H3K9me3 modification, and carrying out somatic cell nuclear transfer by using PEF with reduced H3K9me3 modification as donor cells to improve the somatic cell nuclear transfer developmental capacity. The cell culture solution is prepared from the following components: a DMEM (Dulbecco Modified Eagle Medium) culture medium is used as a basic culture solution, and 15% fetal calf serum, OTS186935, F5446 and SETDB1-TTD-IN-1 are added into the basic culture medium. The culture solution can reduce H3K9me3 modification of donor cell PEF and improve the in-vitro developmental capacity of pig somatic cell nuclear transfer embryos.

The invention belongs to the technical field of cytology, and discloses application of a chromatin remodeling factor Smarcb1 in preparation of a protein marker for regulating and controlling in-vitro cloned embryo epigenetic modification of animal cells. And the chromatin remodeling factor Smarcb1 comprises a variable spliceosome Smarcb1.1 of the chromatin remodeling factor Smarcb1. The invention relates to an oocyte transplanted by using a Smarcb1.1 expression vector constructed by the Smarcb1.1. According to the invention, it is determined that the Smarcb1 adjusts the development condition of the cloned embryo through cell nucleus reprogramming, and the action mechanism of the Smarcb1 on SCNT embryo development is disclosed, so that the developmental rate of the cloned embryo is improved, and the development and application of a somatic cell nucleus transfer technology are promoted.

The application discloses application of sodium crotonate in improving bovine embryo development potential. In the process of culturing bovine SCNT embryos in vitro, adding sodium crotonate (Nacr) with a proper concentration can promote the development of bovine SCNT cells, significantly improve the development rate and blastocyst rate of the SCNT embryos, improve the embryo quality, and further improve the somatic cell nuclear transfer efficiency of pre-implantation embryos. On this basis, the inventors construct a bovine SCNT early embryo in-vitro culture system, optimize the formula of the in-vitro embryo culture solution and the concentration of Nacr, and further establish a method for improving the development potential of early bovine embryos in vitro. The application can improve the development quality of bovine SCNT embryos, provides a research basis for the rapid propagation of high-yield dairy cattle, high-quality beef cattle and even disease-resistant fine breeds, provides a reference for the batch production of high-quality bovine embryos in vitro, and has important practical significance in the field of SCNT embryo in-vitro culture.

The present invention provides methods and compostions to improve the efficiency of somatic cell nuclear transfer (SCNT) and the consequent production of nuclear transfer ESC (ntESC) and transgenic cells and / or non-human animals. More specifically, the present invention relates to the discovery that trimethylation of Histone H3-Lysine 9 (H3K9me3) in reprogramming resistant regions (RRRs) in the nuclear genetic material of donor somatic cells prevents efficient somatic cell nuclear reprogramming or SCNT. The present invention provide methods and compositions to decrease H3K9me3 in methods to improve efficacy of SCNT by exogenous or overexpression of the demethylase Kdm4 family and / or inhibiting methylation of H3K9me3 by inhibiting the histone methyltransferases Suv39h1 and / or Suv39h2.

The invention discloses a bovine ectoderm stem cell line as well as an establishment method and application thereof. The bovine ectoderm stem cell line has the pluripotency of a bovine intermediate state stem cell line, expresses one or more pluripotency markers, can be stably passaged, still maintains pluripotency transcriptome characteristics and normal karyotype similar to those of an intermediate state (Formative) ectoderm cell after more than 112 generations, and has the potential of being differentiated into three-germ layers. The bovine intermediate-state stem cell line has the potential for myogenic differentiation, primordial germ cell-like cell differentiation and serving as somatic cell nuclear transplantation (SCNT) donor cells, which shows that the bovine intermediate-state stem cell line has wide application prospects in the aspects of promoting cell culture meat production and animal breeding.

The invention relates to the technical field of animal gene engineering and biology, in particular to a pig MSTN, pAPN and CD163 gene synchronous editing embryo and a preparation method and application thereof. On the basis of a CRISPR / Cas9 technology, an MSTN exon 1, a CD163 exon 7 and a pAPN exon 2 are selected as targeting areas, efficient sgRNA is designed and screened, an integrated tandem editing vector containing a three-gene sgRNA expression cassette is constructed through homologous recombination, after pig embryo fibroblasts are electrically transfected, puromycin screening and sequencing identification are performed to obtain positive PEF cells, and the positive PEF cells are subjected to high-throughput screening and high-throughput screening. And performing somatic cell nuclear transfer to prepare and synchronously edit embryos. The synchronous editing efficiency of the three genes reaches 8.9%, the fusion rate of the edited embryos is larger than or equal to 70%, the cleavage rate is larger than or equal to 75%, the blastocyst rate is larger than or equal to 12%, the developmental ability is normal, synchronous improvement of genes related to growth performance and disease resistance is achieved, and the method has important industrial application value.

The invention relates to the technical field of animal breeding, in particular to an sgRNA combination and application thereof in preparation of PRNP gene edited sheep. The sgRNA combination comprises a PRNP-sgRNA 1: CCACATAGGCAGTTGGATCC (CCACATAGGCAGTTGGATCC), and a sgRNA combination And PRNP-sgRNA9: CTGGCGGAGGATGGAACACT (cytotoxic T Growth Growth Growth Growth The application comprises the following steps: introducing the sgRNA combination and the gene editor into embryo fibroblasts of sheep to obtain gene edited positive cells; performing somatic cell nuclear transplantation by taking a gene-edited positive cell as a nuclear donor to obtain a reconstructed embryo; and transplanting the reconstructed embryo into a receptor ewe body. A group of sgRNA combinations capable of efficiently and accurately knocking out the sheep PRNP gene is obtained through research and screening, and the sgRNA combinations can be used for preparing anti-brucellosis animal varieties (the 2h brucellosis clearance rate of PBMC cells reaches 100%) and have important application value.

The copy number of the ten-gene edited porcine endogenous retroviruses (PERVs) in a whole genome is determined by ddPCR, and the PERV-Pol genotype is determined through second-generation whole genome deep sequencing. The method comprises the following steps: constructing a porcine PERV-Pol gene knockout targeting vector, co-transfecting the vector into a ten-gene edited porcine fetal fibroblast line, screening to obtain a PERV-Pol knockout fibroblast line, carrying out somatic cell nuclear transfer and embryo transfer, taking out a fetus during pregnancy, and identifying PERV-Pol gene knockout and PERVs inactivation conditions of the fetus. Furthermore, the continuous cloning technology is used for batch production of the PERVs completely inactivated eleven-gene edited xenotransplantation donor pigs. The technical problems that the PERV-Pol gene, especially the multi-copy gene, is high in editing difficulty, low in efficiency and long in period are solved, and the method has important significance on overcoming the problems of biosafety and immunological rejection in the xenogeneic organ transplantation process.

The invention discloses an application of lactobacillus johnsonii in promoting in-vitro maturation of porcine oocytes, and a synergistic regulation system is constructed by optimizing formulas of an oocyte maturation culture solution, an electric activation solution and an embryo culture solution. The application can effectively promote the in-vitro maturation rate of the porcine oocytes to be increased from 68.84% to 77.60%, promote the discharge of first polar bodies, reduce the apoptosis rate of the oocytes and improve the development potential of the oocytes after nuclear transplantation. Therefore, the in-vitro maturation efficiency of the oocytes is improved, the problems of low maturation efficiency, high apoptosis ratio and long culture period at present are solved, and the technical system can provide more high-quality oocytes for somatic cell nuclear transplantation, manual cloning, in-vitro fertilization, transgenic cloning, gene editing and the like, and has a wide application prospect in actual production.

The application discloses a gene editing system for constructing a Huntington's disease model pig nuclear transfer donor cell with a HTT gene mutation and application thereof. The application provides a method for preparing a recombinant pig cell, which comprises the following steps: replacing a target region in chromosomal DNA of a pig cell with a DNA molecule named DNA molecule A to obtain a recombinant pig cell; the DNA molecule A is as follows (I) or (II): (I) a DNA molecule shown in nucleotides 1734-2176 in SEQ ID NO: 16; (II) a DNA molecule shown in nucleotides 1071-2176 in SEQ ID NO: 16; and the target region is a DNA molecule shown in nucleotides 2001-2236 in SEQ ID NO: 9. A cloned pig prepared by somatic cell nuclear transfer animal cloning technology using the recombinant pig cell can be used as a Huntington's disease model pig. The application has great application value for research and development of Huntington's disease drugs and revealing the pathogenesis of the disease.

This invention discloses a modified gRNA and a method for producing heat-resistant dairy cows through gene editing, belonging to the field of genetic engineering technology. The gRNA is composed of an sgRNA sequence linked to a scaffold sequence at the 3' end. Modification includes adding a reverse deoxythymidine to the 3' end of the sgRNA sequence, introducing a phosphate thioester bond at the 5' end, and also includes a PNA sequence. The modified gRNA sequence itself has a gene editing rate as high as 56.02%. After modification, combined with a specific PNA sequence, the gene editing efficiency reaches 88.60%, enabling efficient and precise editing of the PRLR gene. The resulting PRLR gene carries the chr20:39099191-39099267_77bp_del mutation and has a p.Ala464* truncated amino acid sequence. ‑ / ‑ Somatic cell nuclear transfer of embryos has significantly improved the success rate of producing gene-edited cattle.

The invention belongs to the technical field of somatic cell nuclear transfer, and discloses a gene for promoting SCNT embryonic development, a development fate system and a construction method. The gene for promoting the SCNT embryonic development is an RNA (Ribonucleic Acid) interference fragment after Setdb2 knockdown or a gene after Shpry overexpression. The RNA interference fragment with the Setdb2 knocked down comprises a knock-down site Setdb2-1597, and the knock-down sequence of the RNA interference fragment is SEQIDNO: 13 and SEQIDNO: 14. According to the invention, a system for tracking SCNT embryo blastocyte development fate is established through pinhole culture, SCNT embryo transcriptome databases with different developmental capacities are constructed through single cell transcriptome sequencing, and regulation and control effects of Setdb2 and Shpry on SCNT embryo development are clarified through knock-down or overexpression. The method has important scientific guiding significance on improvement and application of SCNT efficiency.

The invention discloses a robotized in-situ operation method for reconstructed embryo electrofusion, and belongs to the technical field of cell-level micromanipulation. According to the method, somatic cell nuclear transplantation operation and reconstructed embryo electrofusion operation are integrated on the same operation platform, and an electrode microneedle with suction and electrical stimulation functions is introduced into a left mechanical arm; the right mechanical arm introduces parallel double needles for nuclear transplantation and electrical stimulation respectively, and the method comprises the following key steps: cell positioning, cell holding, cell enucleation, cell nuclear injection, conversion of an injection needle and an electrode microneedle, electrical stimulation fusion, and finally release of operated cells. According to a traditional reconstructed embryo electrofusion method, a reconstructed embryo subjected to nuclear transfer is transferred to a specially-made parallel electrode plate, electric pulse fusion is applied, and experimental results show that compared with a traditional operation process, the method provided by the invention has the advantages that about 45.3% of time can be saved, and the efficiency and repeatability of reconstructed embryo electrofusion are effectively improved.

The compositions and methods described herein include culturing an oocyte, an ooplast, or an embryo (e.g., an early-stage embryo) in a culture media with a GPCR ligand. Such oocytes can be used for somatic cell nuclear transfer (SCNT) and subsequent cloning and implantation into a recipient female.

An aspect provides a method of increasing efficiency of somatic cell nuclear transfer using a substance (RS-1) increasing Rad51 activity, and a somatic cell nuclear transfer cell prepared according to the method. Another aspect provides a method of screening for a substance increasing Rad51 activity to increase efficiency of somatic cell nuclear transfer. When the substance increasing Rad51 activity is used, efficiency of somatic cell nuclear transfer may be increased.

The application discloses a gene editing system for constructing a model pig of neurofibromatosis type 1 (NF1) gene mutation by nuclear transfer donor cells and application thereof. The application provides a method for preparing a recombinant cell, wherein a DNA molecule shown in SEQ ID NO: 18 is used to replace a DNA molecule shown in SEQ ID NO: 19 in chromosomal DNA of a pig cell, so that a recombinant pig cell is obtained. The application adopts CRISPR / Cas9 technology combined with ssODN homologous recombination technology to perform directional gene editing on the NF1 gene, simulates natural genetic characteristics of neurofibromatosis type 1, and obtains a single cell clone of the NF1 gene directional mutation, thereby laying a foundation for cultivating a model pig of neurofibromatosis type 1 by using somatic cell nuclear transfer animal cloning technology in the later stage.

The invention relates to a system for MSTN / IGF2 double-gene editing and a preparation method and application thereof. By designing and screening an efficient spacer sequence aiming at the MSTN and IGF2 genes and utilizing a Cas12f system to carry out double-gene editing, the MSTN and IGF2 double-gene edited cell line is successfully obtained. Further preparing a cloned embryo through a somatic cell nuclear transfer technology, and transferring the cloned embryo to finally obtain the double-gene edited calf with remarkable phenotype. Experimental results show that the birth weight of the edited calves reaches 55 kg and is remarkably higher than that of the wild calves (31 kg), it is proved that the double-gene editing strategy has the remarkable effect on promoting the growth and weight of the beef cattle, and a new genetic material and a new technical path are provided for beef cattle breeding.

The copy number of the eight-gene edited PERVs in a genome is measured through ddPCR, and the PERV-Pol genotype is determined by utilizing second-generation whole genome deep sequencing. The method comprises the following steps: constructing a porcine PERV-Pol gene knockout targeting vector, jointly transfecting the vector into an eight-gene edited porcine fetal fibroblast line, screening to obtain a PERV-Pol knockout positive fibroblast line, carrying out somatic cell nuclear transfer and embryo transfer, taking out a fetus after pregnancy, and identifying PERV-Pol gene knockout and PERVs inactivation conditions of the fetus. And designing and constructing a targeting sgRNA expression vector again according to the knockout condition, and transfecting the targeting sgRNA expression vector into the PERV-Pol gene knockout fetal fibroblast line until the nine-gene edited pig fibroblast line with completely inactivated PERVs is obtained through screening for somatic cell nuclear transplantation, thereby finally obtaining the nine-gene edited xenotransplantation donor pig with completely inactivated PERVs. According to the invention, the technical problems of high difficulty and low efficiency of editing the endogenous retrovirus, especially the multi-copy gene, are solved, and the problems of biological safety and immunological rejection in the xenogenic organ transplantation process are solved.