Method for preparing high muscle content and hypertrophic cardiomyopathy model cloned pig

A technology for hypertrophic cardiomyopathy and muscle mass, applied in the field of genetic engineering, can solve problems such as hypertrophic cardiomyopathy without the Trim63 gene, and achieve the effects of improving convenience, low cost, and shortening time

Inactive Publication Date: 2016-04-06
CHINA AGRI UNIV
View PDF3 Cites 44 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] For large animals such as pigs, there is no research on the function of Trim63 gene on the maintenance of muscle mass and hypertrophic cardiomyopathy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing high muscle content and hypertrophic cardiomyopathy model cloned pig
  • Method for preparing high muscle content and hypertrophic cardiomyopathy model cloned pig
  • Method for preparing high muscle content and hypertrophic cardiomyopathy model cloned pig

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Construction of CRISPR-Cas9 Targeting Vector

[0042] 1. Use the website of Zhang Feng Laboratory (http: / / crispr.genome-engineering.org / ) to predict the targeting site of exon 1 of the pig Trim63 gene. According to the scores in the self-assessment and prediction results, two candidate target sites were selected, named pM1 and pM9, and their sgRNA sequences were TGGGAACCCCATGGAGAACC (SEQ ID NO.2) and TGACTTATAATCCATATTGT (SEQ ID NO.3). Complementary paired oligonucleotides were synthesized according to the sgRNA sequence, as shown in Table 1, where the lowercase letters are restriction sites.

[0043] Table 1 Oligonucleotide sequence

[0044] name

Sequence (5'-3')

wxya

caccgTGGGAACCCCATGGAGAACC (SEQ ID NO. 4)

PPML

aaacGGTTCTCCATGGGGTTCCCAc (SEQ ID NO. 5)

pM9F

caccgTGACTTATAATCCATATTGT (SEQ ID NO. 6)

pM9R

aaacACAATATGGATTATAAGTCAc (SEQ ID NO. 7)

[0045] 2. A total of two targeting vectors were c...

Embodiment 2

[0054] Construction of embodiment 2 Cas9n targeting vector

[0055] 1. A total of two targeting vectors were constructed, named px335-pM1n and px335-pM9n, respectively using two pairs of oligonucleotides in Table 1. The construction process was as follows: 94°C for 5 minutes, then 35°C for 10 minutes, and then immediately released On ice, anneal the oligonucleotides. The px335 backbone vector was digested with the restriction endonuclease BbsI overnight, and after recovery, it was ligated with the annealed oligonucleotide at 16°C for 3 hours. Transformation and coating are carried out by conventional transformation methods. After a single colony grows, several colonies are picked for expansion and sequenced. The sequencing verification is correct, indicating that the present invention successfully constructs two Cas9n targeting vectors.

[0056] 3. Positive single colony expansion culture

[0057] The specific steps are: a. Initial culture, pick a positive single colony wi...

Embodiment 3

[0064] Example 3 Screening and Identification of Positive Cell Monoclonal

[0065] 1. Screening of positive monoclonal cells

[0066] Digest and collect porcine fibroblasts in one well of a 6-well cell culture plate (approximately 1×10 6 ), mix the targeting vectors px335-pM1n and px335-pM9n constructed in Example 2 at a ratio of 1:1, take a total mass of 4 μg, transfect according to the method of step 5 in Example 2, and put to CO 2 In the incubator, cultivate at 37.5°C. After 48 hours, the confluence of the cells reached 80-90%. At this time, the cells in one well were evenly divided into eight 10cm culture dishes. After 24 hours, the cells adhered to the wall, and the medium was replaced with fibroblast medium (10% FBS+DMEM) containing G418 (600 μg / mL), and the medium was changed every 3 to 4 days. ) fibroblast culture medium. After the cells were cultured for 6-9 days, the formation of cell colony spots could be observed. Find the clones of resistant cells under the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of a Trim63 gene in preparation of a high muscle content and hypertrophic cardiomyopathy model cloned pig. Somatic cells of the Trim63 gene of a modified pig are utilized as nuclear transfer donor cells, oocytes are utilized as nuclear transfer recipient cells, and a cloned embryo is obtained through the somatic cell nuclear transfer technology. The cloned embryo is transferred into a pig uterus to gestate to obtain the Trim63 gene modified high muscle content and hypertrophic cardiomyopathy model cloned pig, artificial intervention methods, such as operation and so on for the cloned pig are not needed any more, and the efficiency of establishment of a disease model is improved. According to the high muscle content and hypertrophic cardiomyopathy model cloned pig, paired Cas9n targeting vectors are utilized for the first time to perform gene editing for large animals. The method is low in cost, sharply shortens the time for obtaining a homozygote pig and lays a foundation for gene function research and the disease model establishment for the large animals by utilizing the CRISPR / Cas9 technology.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a modification of the Trim63 gene by using a CRISPR / Cas9 system and double Cas9n technology. Background technique [0002] Muscle is composed of muscle fibers, and the number of muscle fibers remains essentially the same in animals after birth, so muscle size is primarily determined by the size of the muscle fibers. The size of muscle fiber depends on the balance of protein synthesis and degradation in muscle fiber cells: when protein synthesis is greater than degradation, muscle fiber is hypertrophic, and when protein degradation is greater than synthesis, muscle fiber is atrophy. [0003] As muscle-specific E3 ubiquitin ligases, three-domain protein 63 (tripartitemotif-containing63, Trim63) and F-box protein 32 (F-boxprotein32, Fbxo32) regulate the expression of most sarcoplasmic proteins and muscle growth regulators degradation. Trim63 and Fbxo32 were found to be significa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/877C12N15/85C12N15/66A01K67/027
CPCC12N15/8778A01K67/0273A01K2227/108A01K2267/0375C12N15/66C12N15/8509C12N2800/107C12N2800/80
Inventor李宁胡益清胡晓湘
OwnerCHINA AGRI UNIV