34 results about "Nuclear transplantation" patented technology

The application discloses an embryo culture method and embryo culture solution for improving the quality of pig somatic cell nuclear transfer embryos, wherein a small molecule substance X1 capable of specifically combining with the RepA domain of Xist is added into a pig early embryo culture solution, so as to improve the development quality of pig SCNT embryos.

The invention relates to the technical field of animal breeding, in particular to a method for breeding black sheep. The method comprises the following steps: introducing an expression cassette into a cell to obtain a transgenic cell; and carrying out somatic cell nuclear transplantation cloning by adopting the transgenic cells to obtain the black sheep. The expression cassette comprises an intron of PK5 and beta-globin, and an EDN3 gene, the PK5 comprises a nucleotide sequence as shown in SEQ ID NO. 2; and the EDN3 gene comprises a nucleotide sequence as shown in SEQ ID NO. 4. A specific expression cassette and a carrier are researched, the black sheep of which the skin, hair, tongue, oral mucosa, eye white mucosa, epididymis and ears all become black can be prepared through somatic cell cloning on the basis of cells edited by the carrier, and important application value and economic value are achieved.

This invention discloses a gene editing system for constructing a porcine nuclear transplantation donor cell model of atherosclerosis with double gene mutations in AF and its applications. The invention provides a kit comprising plasmid pKG-U6gRNA (APOE-E2-gRNA2), a target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 25 (FBN1-gRNA4), a target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 26 (FBN1-gRNA6), and FBN1-mutant-ss163 as shown in SEQ ID NO: 27. The kit is used for: preparing recombinant cells; preparing porcine atherosclerosis models; preparing atherosclerosis cell models, atherosclerosis tissue models, or atherosclerosis organ models. The plasmid pKG-U6gRNA (APOE-E2-gRNA2) is transcribed to obtain sgRNA with a target sequence binding region as shown in nucleotides 1-20 of SEQ ID NO: 11. APOE‑E2‑gRNA2 This invention lays the foundation for developing pig models of atherosclerosis through somatic cell nuclear transfer animal cloning technology.

This invention discloses a method for constructing an immune animal model for preparing biofusion enzyme antibodies and its application. The method includes the following steps: designing and screening sgRNAs with high cleavage efficiency based on signal protein genes, and constructing an sgRNA-Cas9 expression vector; linearizing the plasmid by double enzyme digestion, and then ligating it with a signal protein gene fragment containing left and right homologous arms to obtain the Donor plasmid; co-transfecting the sgRNA-Cas9 expression vector and the Donor plasmid into target animal somatic cells, and screening to obtain positive somatic cells that stably integrate the target gene; using the positive somatic cells as nuclear donors for nuclear transfer to construct recombinant embryos, and transferring the recombinant embryos into recipient female animals; after delivery, identifying transgenic animal individuals carrying biofusion enzyme antibodies by genomic PCR. Based on this transgenic animal model, different target antibodies with clinical value can be developed.

The application discloses a kit for constructing an ATM gene mutation ataxia-telangiectasia model pig nuclear transfer donor cell. The application provides a kit comprising ATM-gRNA1 shown in SEQ ID NO: 16, ATM-gRNA4 shown in SEQ ID NO: 17 and NCN protein. The application also provides a method for preparing a recombinant cell: co-transfecting a pig cell with ATM-gRNA1, ATM-gRNA4 and NCN protein to obtain a recombinant cell. The recombinant cell is a recombinant cell with ATM gene mutation. The kit is used for: preparing a recombinant cell; preparing an ataxia-telangiectasia model pig; preparing an ataxia-telangiectasia cell model or an ataxia-telangiectasia tissue model or an ataxia-telangiectasia organ model. The application has great application value for research and development of ataxia-telangiectasia drugs and revealing the pathogenesis of the disease.

This invention discloses a gene editing system for constructing porcine nuclear transplantation donor cells for ALS models with SOD1 gene mutations and its applications. This invention also provides a method for preparing recombinant cells: SOD1- g RNA1 (target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 18), SOD1- g RNA6 (target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 19), SOD1-mutant-ss160 (shown in SEQ ID NO: 20), and NCN protein (Cas9 protein or a fusion protein containing Cas9 protein) were co-transfected into porcine cells to obtain recombinant cells. This invention utilizes CRISPR / Cas9 technology combined with ssODN homologous recombination technology to perform point mutation gene editing of the SOD1 gene, mimicking the natural pathogenesis and genetic characteristics of ALS, and obtaining single-cell clones with precise point mutations in the SOD1 gene. This lays the foundation for later breeding of ALS disease model pigs using somatic cell nuclear transfer animal cloning technology.

This invention relates to the fields of gene editing and animal genetic breeding technology, and discloses a precise editing method for key genes regulating lipid metabolism in cattle and sheep. The method includes: constructing a comprehensive lipid metabolism network map integrating transcriptomic, proteomic, and metabolomic data; using a graph neural network to identify key node genes with high flow weights and their negative feedback pathways; simulating cascade reactions after gene perturbation to assess compensatory effects; screening for multi-gene combinations that do not induce significant compensation and can synergistically regulate fat deposition and muscle growth; designing expression vectors containing multiple guide RNA sequences to achieve simultaneous and precise editing; and obtaining edited individuals and validating the phenotype through embryonic or somatic cell nuclear transfer. This invention, through system-level multi-target synergistic editing, avoids metabolic imbalances, improves editing effectiveness, and promotes muscle development while reducing fat deposition, providing a safe and efficient technical path for precision breeding of cattle and sheep.

The application discloses a gene editing system for constructing a GP130 gene mutation gastric cancer model pig nuclear transfer donor cell and application thereof. The gene editing system comprises a high-efficiency Cas9 protein prepared according to the method of the application, a high-efficiency target gRNA for the GP130 gene screened, and a single-chain Donor DNA containing a GP130 mutation site, and the optimal use amount ratio of the components of the system is optimized, and finally the single-cell clone ratio of the target site point mutation is 22.5%, which is much higher than the conventional point mutation efficiency (<5%).

The present application relates to the field of embryo engineering, and particularly relates to application of mangiferin in promoting maturation of animal oocytes. The present application discloses that mangiferin can promote maturation of animal oocytes, especially maturation of pig oocytes; can improve in-vitro maturation efficiency of oocytes; can reduce the apoptosis rate of oocytes and improve the subsequent development potential of oocytes. Mangiferin can be used to promote in-vitro maturation of oocytes, and can be used to prepare or directly serve as a drug for improving in-vitro maturation and development of oocytes, thereby opening up a new application direction for mangiferin. The present application uses mangiferin to improve in-vitro maturation efficiency of oocytes, solves the problems of low maturation efficiency and long culture period, and provides more high-quality oocytes for somatic cell nuclear transfer, in-vitro fertilization and transgenic cloning by using the technical scheme of mangiferin in the present application, thereby having a wide application prospect in actual production.

The invention discloses a marker for evaluating the development potential of a pig somatic cell nuclear transfer embryo and application, and belongs to the technical field of development of the pig somatic cell nuclear transfer embryo. According to the invention, the endogenous retrovirus MLT2B2 is determined to be used as a functional regulator and a biomarker of the porcine embryo ZGA. The expression of the MLT2B2 in a 4-cell-stage SCNT embryo has obvious heterogeneity, and the embryo of the MLT2B2-generally shows ZGA retardation and low developmental potential. Single-embryo multi-omics analysis and pedigree tracking prove that the activation of the MLT2B2 in a 4-cell stage can be used as a predictive factor of the developmental ability of the SCNT embryo, that is, the MLT2B2 + embryo has recovered chromatin accessibility and transcription fidelity.

This invention provides a method for preparing goats overexpressing the FOXL2 gene, belonging to the field of genetic engineering and transgenic animal technology. The method includes the following steps: transfecting intersex goat embryonic fibroblasts with a vector plasmid overexpressing the FOXL2 gene to obtain a stable monoclonal cell line overexpressing the FOXL2 gene; using the monoclonal cell line as a nuclear donor for nuclear transfer cloning in a recipient goat to obtain cloned goat embryos overexpressing the FOXL2 gene; and transferring the cloned goat embryos into a surrogate goat to produce goats overexpressing the FOXL2 gene. The nucleotide sequence of the FOXL2 gene is shown in SEQ ID NO.1. By overexpressing the FOXL2 gene in intersex goats, the regulatory function of the FOXL2 gene on horn traits is explored, providing insights for reducing or even overcoming the harm of intersex hornless syndrome and obtaining normal hornless dairy goat germplasm.

The application discloses application of a gene editing system in preparation of a spinal muscular atrophy model pig nuclear transfer donor cell with SMN1 gene mutation. The application provides application of SMN1-gRNA3 shown in SEQ ID NO: 16, SMN1-gRNA4 shown in SEQ ID NO: 17 and NCN protein in preparation of a kit. The application also provides a method for preparing a recombinant pig cell: SMN1-gRNA3, SMN1-gRNA4 and NCN protein are co-transfected into a pig cell to obtain a recombinant pig cell. The recombinant pig cell is a recombinant pig cell with SMN1 gene mutation. The kit is used for: preparing a recombinant pig cell; preparing a spinal muscular atrophy model pig; preparing a spinal muscular atrophy cell model or a spinal muscular atrophy tissue model or a spinal muscular atrophy organ model. The application has great application value for research and development of spinal muscular atrophy drugs and revealing the pathogenesis of the disease.

The invention belongs to the technical field of cytology, and discloses application of a chromatin remodeling factor Smarcb1 in preparation of a protein marker for regulating and controlling in-vitro cloned embryo epigenetic modification of animal cells. And the chromatin remodeling factor Smarcb1 comprises a variable spliceosome Smarcb1.1 of the chromatin remodeling factor Smarcb1. The invention relates to an oocyte transplanted by using a Smarcb1.1 expression vector constructed by the Smarcb1.1. According to the invention, it is determined that the Smarcb1 adjusts the development condition of the cloned embryo through cell nucleus reprogramming, and the action mechanism of the Smarcb1 on SCNT embryo development is disclosed, so that the developmental rate of the cloned embryo is improved, and the development and application of a somatic cell nucleus transfer technology are promoted.

The present invention provides methods and compostions to improve the efficiency of somatic cell nuclear transfer (SCNT) and the consequent production of nuclear transfer ESC (ntESC) and transgenic cells and / or non-human animals. More specifically, the present invention relates to the discovery that trimethylation of Histone H3-Lysine 9 (H3K9me3) in reprogramming resistant regions (RRRs) in the nuclear genetic material of donor somatic cells prevents efficient somatic cell nuclear reprogramming or SCNT. The present invention provide methods and compositions to decrease H3K9me3 in methods to improve efficacy of SCNT by exogenous or overexpression of the demethylase Kdm4 family and / or inhibiting methylation of H3K9me3 by inhibiting the histone methyltransferases Suv39h1 and / or Suv39h2.

This invention discloses a gene editing system for constructing porcine nuclear transplantation donor cells for a metoprolol reductase deficiency model with SPR gene mutations and its applications. The invention provides a kit comprising SPR-gRNA1 (SEQ ID NO: 16), SPR-gRNA4 (SEQ ID NO: 17), and NCN protein. The invention also provides a method for preparing recombinant cells: co-transfecting porcine cells with SPR-gRNA1, SPR-gRNA4, and NCN protein to obtain recombinant cells. The recombinant cells are recombinant cells with a mutated SPR gene. The kit is used for: preparing recombinant cells; preparing porcine metoprolol reductase deficiency models; and preparing metoprolol reductase deficiency cell models, tissue models, or organ models. This invention has significant application value for the development of drugs for metoprolol reductase deficiency and for elucidating the pathogenesis of this disease.

The invention relates to the technical field of animal breeding, in particular to an sgRNA combination and application thereof in preparation of PRNP gene edited sheep. The sgRNA combination comprises a PRNP-sgRNA 1: CCACATAGGCAGTTGGATCC (CCACATAGGCAGTTGGATCC), and a sgRNA combination And PRNP-sgRNA9: CTGGCGGAGGATGGAACACT (cytotoxic T Growth Growth Growth Growth The application comprises the following steps: introducing the sgRNA combination and the gene editor into embryo fibroblasts of sheep to obtain gene edited positive cells; performing somatic cell nuclear transplantation by taking a gene-edited positive cell as a nuclear donor to obtain a reconstructed embryo; and transplanting the reconstructed embryo into a receptor ewe body. A group of sgRNA combinations capable of efficiently and accurately knocking out the sheep PRNP gene is obtained through research and screening, and the sgRNA combinations can be used for preparing anti-brucellosis animal varieties (the 2h brucellosis clearance rate of PBMC cells reaches 100%) and have important application value.

The application discloses a gene editing system for constructing a progeria model pig nuclear transfer donor cell with a ZMPSTE24 gene mutation and application thereof. The application provides a kit comprising ZMPSTE24-gRNA2 shown in SEQ ID NO: 16, ZMPSTE24-gRNA4 shown in SEQ ID NO: 17 and NCN protein. The application also provides a method for preparing a recombinant pig cell: co-transfecting ZMPSTE24-gRNA2, ZMPSTE24-gRNA4 and NCN protein into a pig cell to obtain a recombinant pig cell. The recombinant pig cell is a recombinant cell with a ZMPSTE24 gene mutation. The kit is used for: preparing a recombinant pig cell; preparing a progeria model pig; preparing a progeria cell model or a progeria tissue model or a progeria organ model. The application has great application value for the research and development of progeria drugs and the revelation of the pathogenesis of the disease.

The application discloses a method for preparing a breast cancer model pig nuclear transfer donor cell with a BRCA2 gene mutation and a special gene editing system thereof. The application provides a method for preparing a recombinant pig cell: BRCA2-gRNA1, BRCA2-gRNA2 and NCN protein are co-transfected into a pig cell to obtain a recombinant pig cell. The recombinant pig cell is a recombinant cell with a BRCA2 gene mutation. The application provides a kit comprising BRCA2-gRNA1 shown in SEQ ID NO: 16, BRCA2-gRNA2 shown in SEQ ID NO: 17 and NCN protein. The kit is used for: preparing a recombinant pig cell; preparing a breast cancer model pig; preparing a breast cancer cell model or a breast cancer tissue model or a breast cancer organ model. The application has great application value for research and development of a breast cancer drug and revealing the pathogenesis of the disease.

The copy number of the ten-gene edited porcine endogenous retroviruses (PERVs) in a whole genome is determined by ddPCR, and the PERV-Pol genotype is determined through second-generation whole genome deep sequencing. The method comprises the following steps: constructing a porcine PERV-Pol gene knockout targeting vector, co-transfecting the vector into a ten-gene edited porcine fetal fibroblast line, screening to obtain a PERV-Pol knockout fibroblast line, carrying out somatic cell nuclear transfer and embryo transfer, taking out a fetus during pregnancy, and identifying PERV-Pol gene knockout and PERVs inactivation conditions of the fetus. Furthermore, the continuous cloning technology is used for batch production of the PERVs completely inactivated eleven-gene edited xenotransplantation donor pigs. The technical problems that the PERV-Pol gene, especially the multi-copy gene, is high in editing difficulty, low in efficiency and long in period are solved, and the method has important significance on overcoming the problems of biosafety and immunological rejection in the xenogeneic organ transplantation process.

The invention discloses a construction method and application of an immune animal model for preparing a biological fusion enzyme antibody, and the construction method comprises the following steps: according to a signal protein gene, designing and screening to obtain sgRNA with high cutting efficiency, and constructing an sgRNA-Cas9 expression vector; carrying out double enzyme digestion linearization on the plasmid, and carrying out enzyme linkage on the plasmid and a signal protein gene segment containing left and right homologous arms to obtain a Donor plasmid; co-transfecting the sgRNA-Cas9 expression vector and a Donor plasmid into a target animal somatic cell, and screening to obtain a positive somatic cell stably integrated with a target gene; taking the positive somatic cells as nuclear donors for nuclear transfer to construct recombinant embryos, transferring the recombinant embryos into receptor female animal bodies, and performing genome PCR (polymerase chain reaction) identification after delivery to obtain transgenic animal individuals carrying biological fusion enzyme antibodies. Based on the transgenic animal model, different target antibodies which are valuable in clinical application can be developed.

The application discloses a gene editing system and application thereof in constructing a porcine nuclear transfer donor cell of a psoriasis model with a TNIP1 gene mutation. The application provides a kit comprising a TNIP1-gRNA2 shown in SEQ ID NO: 16, a TNIP1-gRNA3 shown in SEQ ID NO: 17 and an NCN protein. The application also provides a method for preparing a recombinant porcine cell: the TNIP1-gRNA2, the TNIP1-gRNA3 and the NCN protein are co-transfected into a porcine cell to obtain the recombinant porcine cell. The recombinant porcine cell is a recombinant cell with a TNIP1 gene mutation. The kit is used for: preparing the recombinant porcine cell; preparing a psoriasis model pig; preparing a psoriasis cell model or a psoriasis tissue model or a psoriasis organ model. The application has great application value for research and development of a psoriasis drug and revealing a pathogenesis of the disease.

The application discloses a gene editing system for constructing a Huntington's disease model pig nuclear transfer donor cell with a HTT gene mutation and application thereof. The application provides a method for preparing a recombinant pig cell, which comprises the following steps: replacing a target region in chromosomal DNA of a pig cell with a DNA molecule named DNA molecule A to obtain a recombinant pig cell; the DNA molecule A is as follows (I) or (II): (I) a DNA molecule shown in nucleotides 1734-2176 in SEQ ID NO: 16; (II) a DNA molecule shown in nucleotides 1071-2176 in SEQ ID NO: 16; and the target region is a DNA molecule shown in nucleotides 2001-2236 in SEQ ID NO: 9. A cloned pig prepared by somatic cell nuclear transfer animal cloning technology using the recombinant pig cell can be used as a Huntington's disease model pig. The application has great application value for research and development of Huntington's disease drugs and revealing the pathogenesis of the disease.

The application discloses a gene editing system for constructing a phenylketonuria model pig nuclear transfer donor cell with a PAH gene mutation and application thereof. The application provides a kit comprising PAH-gRNA1 shown in SEQ ID NO: 16, PAH-gRNA4 shown in SEQ ID NO: 17 and NCN protein. The application also provides a method for preparing a recombinant cell: co-transfecting a pig cell with PAH-gRNA1, PAH-gRNA4 and NCN protein to obtain a recombinant cell. The recombinant cell is a recombinant cell with a mutated PAH gene. The kit is used for: preparing a recombinant cell; preparing a phenylketonuria model pig; preparing a phenylketonuria cell model, a phenylketonuria tissue model or a phenylketonuria organ model. The application has great application value for the research and development of phenylketonuria drugs and the revelation of the pathogenesis of the disease.

This invention discloses a modified gRNA and a method for producing heat-resistant dairy cows through gene editing, belonging to the field of genetic engineering technology. The gRNA is composed of an sgRNA sequence linked to a scaffold sequence at the 3' end. Modification includes adding a reverse deoxythymidine to the 3' end of the sgRNA sequence, introducing a phosphate thioester bond at the 5' end, and also includes a PNA sequence. The modified gRNA sequence itself has a gene editing rate as high as 56.02%. After modification, combined with a specific PNA sequence, the gene editing efficiency reaches 88.60%, enabling efficient and precise editing of the PRLR gene. The resulting PRLR gene carries the chr20:39099191-39099267_77bp_del mutation and has a p.Ala464* truncated amino acid sequence. ‑ / ‑ Somatic cell nuclear transfer of embryos has significantly improved the success rate of producing gene-edited cattle.

The invention belongs to the technical field of somatic cell nuclear transfer, and discloses a gene for promoting SCNT embryonic development, a development fate system and a construction method. The gene for promoting the SCNT embryonic development is an RNA (Ribonucleic Acid) interference fragment after Setdb2 knockdown or a gene after Shpry overexpression. The RNA interference fragment with the Setdb2 knocked down comprises a knock-down site Setdb2-1597, and the knock-down sequence of the RNA interference fragment is SEQIDNO: 13 and SEQIDNO: 14. According to the invention, a system for tracking SCNT embryo blastocyte development fate is established through pinhole culture, SCNT embryo transcriptome databases with different developmental capacities are constructed through single cell transcriptome sequencing, and regulation and control effects of Setdb2 and Shpry on SCNT embryo development are clarified through knock-down or overexpression. The method has important scientific guiding significance on improvement and application of SCNT efficiency.

The invention discloses a robotized in-situ operation method for reconstructed embryo electrofusion, and belongs to the technical field of cell-level micromanipulation. According to the method, somatic cell nuclear transplantation operation and reconstructed embryo electrofusion operation are integrated on the same operation platform, and an electrode microneedle with suction and electrical stimulation functions is introduced into a left mechanical arm; the right mechanical arm introduces parallel double needles for nuclear transplantation and electrical stimulation respectively, and the method comprises the following key steps: cell positioning, cell holding, cell enucleation, cell nuclear injection, conversion of an injection needle and an electrode microneedle, electrical stimulation fusion, and finally release of operated cells. According to a traditional reconstructed embryo electrofusion method, a reconstructed embryo subjected to nuclear transfer is transferred to a specially-made parallel electrode plate, electric pulse fusion is applied, and experimental results show that compared with a traditional operation process, the method provided by the invention has the advantages that about 45.3% of time can be saved, and the efficiency and repeatability of reconstructed embryo electrofusion are effectively improved.

The invention discloses a technology for inducing mitochondrial membrane damage and an autophagy degradation mechanism based on Raptinal. The technology is used for reducing the content of residual mutation mtDNA carried in the mitochondrial replacement process. According to the method, before nuclear transfer (PNT), a nuclear donor embryo containing mutated mtDNA is placed in a Raptinal operating solution for short-time incubation, so that a mutated mitochondrial membrane is depolarized and damaged, and then the mutated mitochondrial membrane is selectively cleared through the mitochondrial autophagy effect of a nuclear receptor embryo, so that the co-transfer of the mutated mtDNA is remarkably reduced. And cell apoptosis is avoided by adding a pan-caspase inhibitor, so that the balance between membrane injury and embryo survival is realized. C57BL / 6J and BALB / c mice are taken as models, allele-specific PCR (polymerase chain reaction) is used for detecting mtDNA residues of reconstructed embryos, and results show that the detection rate of mutated mtDNA can be reduced from 100% to 30% and the carrying rate of the mutated mtDNA is reduced by more than 70% through Raptinal treatment. The method is easy and convenient to operate, safe, reliable and suitable for the mammalian mitochondrial replacement process, and an efficient new scheme is provided for preventing maternal mitochondrial genetic diseases.

An aspect provides a method of increasing efficiency of somatic cell nuclear transfer using a substance (RS-1) increasing Rad51 activity, and a somatic cell nuclear transfer cell prepared according to the method. Another aspect provides a method of screening for a substance increasing Rad51 activity to increase efficiency of somatic cell nuclear transfer. When the substance increasing Rad51 activity is used, efficiency of somatic cell nuclear transfer may be increased.

This invention discloses a kit and its application in constructing recombinant porcine cells that specifically express the human type II 5α-reductase gene in hair follicle tissue. The kit provides employs a CRISPR / Cas9 system and homologous recombination technology to prepare recombinant porcine cells with a specific DNA molecule integrated at a specific location in the genome. The expression of the human type II 5α-reductase gene in this specific DNA molecule is driven by the KAP6.1 promoter. This invention also provides a method for preparing recombinant porcine cells, comprising the following steps: integrating a DNA molecule named DNA molecule A into the genomic DNA of porcine cells to obtain recombinant porcine cells; wherein DNA molecule A contains the KAP6.1 promoter and the human type II 5α-reductase gene, and the expression of the human type II 5α-reductase gene is driven by the KAP6.1 promoter. These recombinant porcine cells can be used as nuclear transfer cell donors to clone and produce alopecia model pigs, which will contribute to the study and elucidation of the pathogenesis of androgenetic alopecia and can be used for drug screening, efficacy testing, gene and cell therapy research.

The copy number of the eight-gene edited PERVs in a genome is measured through ddPCR, and the PERV-Pol genotype is determined by utilizing second-generation whole genome deep sequencing. The method comprises the following steps: constructing a porcine PERV-Pol gene knockout targeting vector, jointly transfecting the vector into an eight-gene edited porcine fetal fibroblast line, screening to obtain a PERV-Pol knockout positive fibroblast line, carrying out somatic cell nuclear transfer and embryo transfer, taking out a fetus after pregnancy, and identifying PERV-Pol gene knockout and PERVs inactivation conditions of the fetus. And designing and constructing a targeting sgRNA expression vector again according to the knockout condition, and transfecting the targeting sgRNA expression vector into the PERV-Pol gene knockout fetal fibroblast line until the nine-gene edited pig fibroblast line with completely inactivated PERVs is obtained through screening for somatic cell nuclear transplantation, thereby finally obtaining the nine-gene edited xenotransplantation donor pig with completely inactivated PERVs. According to the invention, the technical problems of high difficulty and low efficiency of editing the endogenous retrovirus, especially the multi-copy gene, are solved, and the problems of biological safety and immunological rejection in the xenogenic organ transplantation process are solved.