Method for obtaining lymphoma minipig disease model by knocking out P53 genes
A disease model, a technology of miniature pigs, applied in the field of medical animal disease models, can solve the problems of small size of miniature pigs, cessation of cell growth, high cost of treatment, etc., and achieve the effects of less injury, high controllability, and easy promotion and use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0075] The specific steps of the method for obtaining the lymphoma minipig disease model by knocking out the P53 gene are as follows:
[0076] The first step, the design, assembly and extracellular activity detection of P53 gene knockout TALEN plasmid pair
[0077] 1) Design the TALEN target in the fourth exon region according to the porcine P53 gene sequence on NCBI;
[0078] 2) Assemble TALEN plasmids pCAG-pP53-L and pCAG-pP53-R, for the left TALEN recognition sequence: TCTGGAACAGCCAAGT, the RVD sequence is as follows: NGHDNGNNNNNINIHDNINNHDHDDNININNNG; for the right TALEN recognition sequence: CCCTCAAGGCCACTGAC, the RVD sequence is as follows: HDHDHDNGHDNINNNNHDHDNIHDNGNNNIHD, respectively, according to the left and right RVD sequences Correspondingly assembled into plasmids pCAG-pP53-L and pCAG-pP53-R;
[0079] 3) Detection of extracellular activity of TALEN plasmid pair, a terminator is in the center of the coding region of luciferase, luciferase has no activity, in orde...
Embodiment 2
[0102] The specific steps of the method for obtaining the lymphoma minipig disease model by knocking out the P53 gene are as follows:
[0103] The first step, the design, assembly and extracellular activity detection of P53 gene knockout TALEN plasmid pair
[0104] 1) According to the porcine P53 gene sequence on NCBI, design the TALEN target in the fourth exon region. The target sequence is:
[0105] TCTGGAACAGCCAAGTCTGTAACCTGCACGGTCAGTGGCCTTGAGGG;
[0106] 2) Assemble TALEN plasmids pCAG-pP53-L and pCAG-pP53-R, for the left TALEN recognition sequence: TCTGGAACAGCCAAGT, the RVD sequence is as follows: NGHDNGNNNNNINIHDNINNHDHDDNININNNG; for the right TALEN recognition sequence: CCCTCAAGGCCACTGAC, the RVD sequence is as follows: HDHDHDNGHDNINNNNHDHDNIHDNGNNNIHD, respectively, according to the left and right RVD sequences Correspondingly assembled into plasmids pCAG-pP53-L and pCAG-pP53-R;
[0107] 3) Detection of extracellular activity of TALEN plasmid pair, a terminator is i...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com