Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Encoding gene of glycoside hydrolase for rapid hydrolysizing xylan to generate single xylose, and application of encoding gene

A technology of glycoside hydrolase and xylan, applied in the field of coding genes of glycoside hydrolase

Pending Publication Date: 2019-04-26
CHINA AGRI UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although multifunctional enzymes related to xylan hydrolysis have been reported, they can efficiently hydrolyze xylan to produce a single product xylose while simultaneously exerting β-xylosidase, β-xylanase and α-L-arabinofuranoside Enzymes Enzymes not reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Encoding gene of glycoside hydrolase for rapid hydrolysizing xylan to generate single xylose, and application of encoding gene
  • Encoding gene of glycoside hydrolase for rapid hydrolysizing xylan to generate single xylose, and application of encoding gene
  • Encoding gene of glycoside hydrolase for rapid hydrolysizing xylan to generate single xylose, and application of encoding gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] This example is used to illustrate the construction of the recombinant strain containing the Ttxy43 gene of the present invention.

[0058] (1) Acquisition of Ttxy43 gene

[0059] The nucleic acid sequence shown in SEQ ID NO:2 was synthesized.

[0060] Design of specific primers Ttxy43-F / Ttxy43-R

[0061] Ttxy43-F: CGGAATTCATGGCTCCATTGATCACCAA (SEQ ID NO: 8)

[0062] Ttxy43-R: GGGGTACCTTACTCTGGCTTCTCGGTA (SEQ ID NO: 9)

[0063] Using the nucleic acid sequence shown in SEQ ID NO: 2 as a template and Ttxy43-F / Ttxy43-R as primers for PCR amplification, the reaction parameters of PCR are: denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, Extended at 72°C, and continued to extend at 72°C for 10 min after 30 cycles to obtain a Ttxy43 gene fragment (SEQ ID NO: 2).

[0064] (2) Construction of recombinant strains

[0065]Use restriction endonucleases EcoR I and Kpn I to digest the Ttxy43 gene fragment and the pPICZαA plasmid...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene engineering, in particular to an encoding gene of glycoside hydrolase for rapid hydrolysizing xylan to generate single xylose, and application of the encoding gene. The nucleotide sequence of the gene is shown in SEQ ID NO. 2. The nucleic acid, which is provided by the invention and is shown in the SEQ ID NO. 2, can be expressed in a large amount in yeast, so that a large amount of the glycoside hydrolase Ttxy43 can be obtained; the glycoside hydrolase Ttxy43 has the activities of beta-xylosidase, endo-beta-xylanase and alpha-L-arabinofuranosidease atthe same time; in addition, the glycoside hydrolase Ttxy43 can directly degrade birch xylan so as to produce a single product xylose; compared with commercial combination of endo-beta xylanase and beta-xylosidase, the glycoside hydrolase Ttxy43 is higher in xylose yield and has a higher commercial application value.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a coding gene of a glycoside hydrolase that quickly hydrolyzes xylan to generate single xylose and its application. Background technique [0002] The highest content of hemicellulose is xylan, and its complete hydrolysis requires the synergy of a variety of enzymes, the most important of which include endoxylanase (EC 3.2.1.8) and xylosidase (EC3. 2.1.37). Endoxylanase can cut the main chain of xylan to generate xylooligosaccharides with non-uniform length, and xylooligosaccharides can be further hydrolyzed by xylosidase to generate xylose, which can be absorbed by tree trunks Yeast or Saccharomyces cerevisiae engineered to produce ethanol. [0003] Glycoside hydrolase family 43 (GH43) (http: / / www.cazy.org) mainly contains β-xylosidase, α-L-arabinofuranosidase, endo-α-L-polyarabinase and 1,3 - β-galactosidase activity, among which β-xylosidase has a large number and is often...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/24C12N15/56C12N15/70C12N15/81C12N15/75C12N1/21C12N1/19C12P19/02C12P19/14C12R1/19C12R1/125C12R1/84C12R1/865
CPCC12N9/2402C12N9/2482C12N9/2485C12P19/02C12P19/14C12Y302/01055
Inventor 楼慧强姜伟刘军权阿卜杜拉·巴西特苗挺宋丽娜温家琦李颖李季伦
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com