Application of DICER1 gene and siRNA thereof
A technology of transgenic pigs and factors, applied in the field of anti-virus research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1 Effect of knocking down DICER1 on HP-PRRSV replication in PAMs cells
[0038] (1) DICER1 siRNA transfection and cell inoculation:
[0039] 1) Plating: Isolate porcine alveolar macrophages from the lung tissue of 6-week-old piglets, perform cell counting and plating, and store at 37°C in 5% CO 2 Cultivated in an incubator;
[0040] 2) Transfection: The transfection reagent was Lipofectamine RNAiMAX Reagent from Life Tech Company, and the transfection was performed according to the operation steps of the transfection reagent. 12 hours after plating, a transfection mixture was prepared (siRNA of DICER1 and Lipofectamine RNAiMAX Reagent were dissolved in Opti-MEM respectively, and the two were mixed) and incubated at room temperature for 5 minutes. Take the 24-well plate out of the incubator, wash it with PBS and replace it with Opti-MEM, add the mixture drop by drop, shake and mix well, and culture it in the cell culture incubator;
[0041] 3) Inoculation: Ino...
Embodiment 2
[0076] Example 2 Effect of knocking down DICER1 on N-PRRSV replication in PAMs cells
[0077] (1) DICER1 siRNA transfection and cell inoculation:
[0078] Plating, transfection, inoculation (0.1 MOIN-PRRSV CH1a) and sample collection were the same as in Example 1.
[0079] (2) RT-qPCR detection of relative expression levels of DICER1 and PRRSV ORF7 mRNA in PAMs
[0080] Extraction of RNA in cells, conversion to cDNA and RT-qPCR detection are the same as in Example 1.
[0081] The relative expression of DICER1 mRNA in PAMs was as follows Figure 5 As shown, when PAMs were transfected with siRNA against DICER1 and then infected with N-PRRSV CH1a strain, the relative expression of DICER1 mRNA in PAMs was reduced by 83.4% compared with the control siRNA group at 0hpi, 12hpi, 24hpi and 36hpi. %, 90.3%, 71.2% and 77.2%.
[0082] The results of relative expression of PRRSV ORF7 mRNA were as follows: Image 6 As shown, when PAMs were transfected with siRNA against DICER1 and then...
Embodiment 3
[0090] Example 3 Effect of knocking down DICER1 on NADC30-like replication in PAMs cells
[0091] (1) DICER1 siRNA transfection and cell inoculation:
[0092] Plating, transfection, inoculation (0.01MOI NADC30-like) and sample collection were the same as in Example 1.
[0093] (2) RT-qPCR detection of relative expression levels of DICER1 and PRRSV ORF7 mRNA in PAMs
[0094] Extraction of RNA in cells, conversion to cDNA and RT-qPCR detection are the same as in Example 1.
[0095] RT-qPCR primers are:
[0096] NADC30-like-ORF7-F: ATGGCCAGCCAGTCAATCAGCTGTG; SEQ ID NO. 10;
[0097] NADC30-like-ORF7-R: CCCGGTCCCTTGCCTCTGGACTGGT; SEQ ID NO.11.
[0098] The relative expression of DICER1 mRNA in PAMs was as follows Figure 9 As shown, when PAMs were transfected with siRNA against DICER1 and then infected with NADC30-like strains, the relative expression of DICER1 mRNA in PAMs was reduced by 70.5% compared with the control siRNA group at 0hpi, 12hpi, 24hpi and 36hpi , 61.1%, 65%...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com