Application of DICER1 gene and siRNA thereof

A technology of transgenic pigs and factors, applied in the field of anti-virus research

Active Publication Date: 2019-04-30
NORTHWEST A & F UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no relevant report on whether the DICER1 gene mutation affects the replication and proliferation of PRRSV

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of DICER1 gene and siRNA thereof
  • Application of DICER1 gene and siRNA thereof
  • Application of DICER1 gene and siRNA thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Effect of knocking down DICER1 on HP-PRRSV replication in PAMs cells

[0038] (1) DICER1 siRNA transfection and cell inoculation:

[0039] 1) Plating: Isolate porcine alveolar macrophages from the lung tissue of 6-week-old piglets, perform cell counting and plating, and store at 37°C in 5% CO 2 Cultivated in an incubator;

[0040] 2) Transfection: The transfection reagent was Lipofectamine RNAiMAX Reagent from Life Tech Company, and the transfection was performed according to the operation steps of the transfection reagent. 12 hours after plating, a transfection mixture was prepared (siRNA of DICER1 and Lipofectamine RNAiMAX Reagent were dissolved in Opti-MEM respectively, and the two were mixed) and incubated at room temperature for 5 minutes. Take the 24-well plate out of the incubator, wash it with PBS and replace it with Opti-MEM, add the mixture drop by drop, shake and mix well, and culture it in the cell culture incubator;

[0041] 3) Inoculation: Ino...

Embodiment 2

[0076] Example 2 Effect of knocking down DICER1 on N-PRRSV replication in PAMs cells

[0077] (1) DICER1 siRNA transfection and cell inoculation:

[0078] Plating, transfection, inoculation (0.1 MOIN-PRRSV CH1a) and sample collection were the same as in Example 1.

[0079] (2) RT-qPCR detection of relative expression levels of DICER1 and PRRSV ORF7 mRNA in PAMs

[0080] Extraction of RNA in cells, conversion to cDNA and RT-qPCR detection are the same as in Example 1.

[0081] The relative expression of DICER1 mRNA in PAMs was as follows Figure 5 As shown, when PAMs were transfected with siRNA against DICER1 and then infected with N-PRRSV CH1a strain, the relative expression of DICER1 mRNA in PAMs was reduced by 83.4% compared with the control siRNA group at 0hpi, 12hpi, 24hpi and 36hpi. %, 90.3%, 71.2% and 77.2%.

[0082] The results of relative expression of PRRSV ORF7 mRNA were as follows: Image 6 As shown, when PAMs were transfected with siRNA against DICER1 and then...

Embodiment 3

[0090] Example 3 Effect of knocking down DICER1 on NADC30-like replication in PAMs cells

[0091] (1) DICER1 siRNA transfection and cell inoculation:

[0092] Plating, transfection, inoculation (0.01MOI NADC30-like) and sample collection were the same as in Example 1.

[0093] (2) RT-qPCR detection of relative expression levels of DICER1 and PRRSV ORF7 mRNA in PAMs

[0094] Extraction of RNA in cells, conversion to cDNA and RT-qPCR detection are the same as in Example 1.

[0095] RT-qPCR primers are:

[0096] NADC30-like-ORF7-F: ATGGCCAGCCAGTCAATCAGCTGTG; SEQ ID NO. 10;

[0097] NADC30-like-ORF7-R: CCCGGTCCCTTGCCTCTGGACTGGT; SEQ ID NO.11.

[0098] The relative expression of DICER1 mRNA in PAMs was as follows Figure 9 As shown, when PAMs were transfected with siRNA against DICER1 and then infected with NADC30-like strains, the relative expression of DICER1 mRNA in PAMs was reduced by 70.5% compared with the control siRNA group at 0hpi, 12hpi, 24hpi and 36hpi , 61.1%, 65%...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a DICER1 gene and siRNA thereof in the influence of PRRSV duplication. si-RNA is used to knock-down DICER1, then the influence of DICER1 on a PRRSV infected host cell is detected by qRT-PCR and TCID50; after the host factor DICER1 is specifically knocked-down, the duplication and proliferation of PRRSV are influenced; the specific siRNA of the host factorDICER1 can be used to develop drugs for preventing and treating PRRSV; and corresponding gene DICER1 can be applied to research on PRRSV transgenic pigs.

Description

technical field [0001] The invention relates to the technical field of antiviral research, and more specifically relates to the application of a DICER1 gene and siRNA thereof in influencing PRRSV replication. Background technique [0002] Porcine reproductive and respiratory syndrome (PRRS) is the most serious pig disease causing economic losses in North America, Europe and Asia. The pathogen of the disease is PRRS virus (PRRSV), which mainly causes piglet respiratory disease, poor growth performance, reproductive disorders and intrauterine infection. Reproductive disorders accounted for about 45% of the losses caused by PRRS, mainly abortion, stillbirth, mummification and respiratory diseases in newborn piglets. At its worst, reproductive failure can lead to 90% mortality in newborn piglets. Pigs that survive uterine infection later become infected pigs, resulting in endemic herds. [0003] PRRSV can be divided into European genotype (type 1) and North American genotype ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113A61K31/713A61P31/14
CPCA61P31/14A61K31/713C12N15/113C12N2310/141
Inventor肖书奇李爽张晓彬
OwnerNORTHWEST A & F UNIV