Recombinant bacillus subtilis for synthesizing lacto-N-neotetraose based on balanced UDP-sugar supply and construction method and application thereof

A technology of Bacillus subtilis and its construction method, which is applied in the field of recombinant Bacillus subtilis and its construction, can solve the problems of insufficient catalytic activity and limited high-efficiency synthesis of products, and achieve the effect of increasing yield and high-efficiency synthesis

Active Publication Date: 2019-05-31
BRIGHT DAIRY & FOOD
View PDF12 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

UDP-galactose and acetylglucosamine uridine diphosphate in its own pathway are the key precursors for synthesis, but due to insufficient catalytic activity of key enzymes in the synthesis pathway of these two UDP-sugars, and between the precursors Supply imbalance limits efficient synthesis of products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus subtilis for synthesizing lacto-N-neotetraose based on balanced UDP-sugar supply and construction method and application thereof
  • Recombinant bacillus subtilis for synthesizing lacto-N-neotetraose based on balanced UDP-sugar supply and construction method and application thereof
  • Recombinant bacillus subtilis for synthesizing lacto-N-neotetraose based on balanced UDP-sugar supply and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Recombinant PZL (P 43 -lacY) fragment construction

[0033] Using the Bacillus subtilis (Bacillus subtilis 168) genome as a template, and according to the amyE gene (Gene ID: 938356) published on NCBI, the primers for the homology arms on both sides were designed, and the sequences were the left sides of SEQ ID NO:1 and SEQ ID NO:2 Side homology arm primers:

[0034] amyE-1F:5'-TATTCCGTATGTCAAGTGGCTGCGGTTTAT-3' (SEQ ID NO: 1),

[0035] amyE-1R:5'- AATTGTTATCCGCTCTCTTGACACTCCTTATTTGA TTTTTTGAAG ACTTACTTCGG-3' (SEQ ID NO: 2),

[0036] The sequences are respectively the right homology arm primers of SEQ ID NO:3 and SEQ ID NO:4:

[0037] amyE-2F:5'- CTTAAGGGCAAGGCTAGACGGGACTTA -3' (SEQ ID NO: 3),

[0038] amyE-2R:5'-GGCACACCGATGTACACGTCATC-3' (SEQ ID NO:4),

[0039] Use the above primers to amplify the homology arm gene sequences on both sides of amyE from the Bacillus subtilis genome; use the plasmid pP43NMK as a template to design primers whose sequen...

Embodiment 2

[0052] Example 2 Recombinant P xylA - Construction of comk fragments

[0053] With the Bacillus subtilis (Bacillus subtilis 168) genome as a template, the homology arm primers on both sides are designed, and the sequences are respectively the left homology arm primers of SEQ ID NO:14 and SEQ ID NO:15:

[0054] yhzC-F:5'-CATACATAGGAAGCAGGCATTGTTCATAAC-3' (SEQ ID NO: 14),

[0055] yhzC-R:5'- atacgggatcaaatccgatgaaagagaaaaaatcgtacactgagctc -3' (SEQ ID NO: 15),

[0056] The sequences are respectively the right homology arm primers of SEQ ID NO:16 and SEQ ID NO:17:

[0057] comK-F:5'- aagggggaaatgggatccatgagtcagaaaacagacgcacct -3' (SEQ ID NO: 16),

[0058] comK-R: 5'-ACTACCTCAGTTGAAGGCTATAATCCAAG-3' (SEQ ID NO: 17),

[0059] Use the above primers from the homology arm gene sequences on both sides of the Bacillus subtilis genome; use the plasmid pLCx-dcas9 as a template to design primers whose sequences are SEQ ID NO:18 and SEQ ID NO:19:

[0060] P xylA -F:5'- tttctctt...

Embodiment 3

[0066] Example 3 Construction of p7S6P43-lgtB fragment

[0067] With the Bacillus subtilis (Bacillus subtilis 168) genome as a template, the homology arm primers on both sides are designed, and the sequences are respectively the left homology arm primers of SEQ ID NO:23 and SEQ ID NO:24:

[0068] ydeS-F:5'-gggacaaggaatagtaagccggcaa-3' (SEQ ID NO:23),

[0069] ydeS-R:5'- tcctgtgtgaaattgttatccgctcctacatactctctgtagcagaggtagcttga '(SEQ ID NO:24),

[0070] The sequences are respectively the right homology arm primers of SEQ ID NO:25 and SEQ ID NO:26:

[0071] ydzO-F:5'- tgaagcccgcctaatgagcgggcttttttctgataagaactgcaaaagctgcggatt at -3' (SEQ ID NO: 25),

[0072] ydzO-R:5'-ccaccctatagataaatttttcggctgccatat-3' (SEQ ID NO:26),

[0073] The gene sequences on both sides of the homology arms were amplified from the Bacillus subtilis genome using the above primers.

[0074] Using the plasmid p7S6P43 as a template, the primers whose sequences were SEQ ID NO:27 and SEQ ID NO:28 wer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for synthesizing lacto-N-neotetraose based on balanced UDP-sugar supply. Recombinant bacillus subtilis is obtained by integrating two beta-1,4-galactosyltransferases,integrating a glucose-6-phosphate isomerase gene, a glutamine-fructose-6-phosphate aminotransferase gene, a UTP-glucose-1-phosphate uridyl transferase gene and a UDP-glucose-epimerase gene, knocking out a UDP-glucose 6-dehydrogenase gene and exogenously expressing a beta-1,3-N-glucosamine transferase gene on a genome of a host bacterium bacillus subtilis 168 delta amyE: P43-lacY, P43-lgtB and PxylA-comK. The recombinant bacillus subtilis synthesizes the lacto-N-neotetraose, and the yield on a shake flask can reach 1800 mg / L, and the efficient synthesis of the lacto-N-tetraose is achieved.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a recombinant Bacillus subtilis for synthesizing lactoyl-N-neotetrasaccharide based on balanced UDP-sugar supply and its construction method and application. Background technique [0002] Lactoyl-N-neotetrasaccharide is one of the important oligosaccharide components in breast milk. It has important physiological functions such as promoting cell differentiation, improving the immune regulation function of intestinal epithelial cells, and increasing the relative abundance of intestinal probiotics. European Food Safety Authority (EFSA) and the US FDA approved as food additives. So far, lactoyl-N-neotetrasaccharide has only been found in human milk, and its extraction from human milk is not suitable for large-scale production. Due to the cumbersome steps of chemical synthesis, low conversion rate, and the disadvantage of expensive substrates in enzymatic synt...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/75C12P19/00C12R1/125
Inventor刘龙董晓敏吕雪芹李江华堵国成陈坚
OwnerBRIGHT DAIRY & FOOD