Recombinant bacillus subtilis for synthesizing lacto-N-neotetraose based on balanced UDP-sugar supply and construction method and application thereof
A technology of Bacillus subtilis and its construction method, which is applied in the field of recombinant Bacillus subtilis and its construction, can solve the problems of insufficient catalytic activity and limited high-efficiency synthesis of products, and achieve the effect of increasing yield and high-efficiency synthesis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 Recombinant PZL (P 43 -lacY) fragment construction
[0033] Using the Bacillus subtilis (Bacillus subtilis 168) genome as a template, and according to the amyE gene (Gene ID: 938356) published on NCBI, the primers for the homology arms on both sides were designed, and the sequences were the left sides of SEQ ID NO:1 and SEQ ID NO:2 Side homology arm primers:
[0034] amyE-1F:5'-TATTCCGTATGTCAAGTGGCTGCGGTTTAT-3' (SEQ ID NO: 1),
[0035] amyE-1R:5'- AATTGTTATCCGCTCTCTTGACACTCCTTATTTGA TTTTTTGAAG ACTTACTTCGG-3' (SEQ ID NO: 2),
[0036] The sequences are respectively the right homology arm primers of SEQ ID NO:3 and SEQ ID NO:4:
[0037] amyE-2F:5'- CTTAAGGGCAAGGCTAGACGGGACTTA -3' (SEQ ID NO: 3),
[0038] amyE-2R:5'-GGCACACCGATGTACACGTCATC-3' (SEQ ID NO:4),
[0039] Use the above primers to amplify the homology arm gene sequences on both sides of amyE from the Bacillus subtilis genome; use the plasmid pP43NMK as a template to design primers whose sequen...
Embodiment 2
[0052] Example 2 Recombinant P xylA - Construction of comk fragments
[0053] With the Bacillus subtilis (Bacillus subtilis 168) genome as a template, the homology arm primers on both sides are designed, and the sequences are respectively the left homology arm primers of SEQ ID NO:14 and SEQ ID NO:15:
[0054] yhzC-F:5'-CATACATAGGAAGCAGGCATTGTTCATAAC-3' (SEQ ID NO: 14),
[0055] yhzC-R:5'- atacgggatcaaatccgatgaaagagaaaaaatcgtacactgagctc -3' (SEQ ID NO: 15),
[0056] The sequences are respectively the right homology arm primers of SEQ ID NO:16 and SEQ ID NO:17:
[0057] comK-F:5'- aagggggaaatgggatccatgagtcagaaaacagacgcacct -3' (SEQ ID NO: 16),
[0058] comK-R: 5'-ACTACCTCAGTTGAAGGCTATAATCCAAG-3' (SEQ ID NO: 17),
[0059] Use the above primers from the homology arm gene sequences on both sides of the Bacillus subtilis genome; use the plasmid pLCx-dcas9 as a template to design primers whose sequences are SEQ ID NO:18 and SEQ ID NO:19:
[0060] P xylA -F:5'- tttctctt...
Embodiment 3
[0066] Example 3 Construction of p7S6P43-lgtB fragment
[0067] With the Bacillus subtilis (Bacillus subtilis 168) genome as a template, the homology arm primers on both sides are designed, and the sequences are respectively the left homology arm primers of SEQ ID NO:23 and SEQ ID NO:24:
[0068] ydeS-F:5'-gggacaaggaatagtaagccggcaa-3' (SEQ ID NO:23),
[0069] ydeS-R:5'- tcctgtgtgaaattgttatccgctcctacatactctctgtagcagaggtagcttga '(SEQ ID NO:24),
[0070] The sequences are respectively the right homology arm primers of SEQ ID NO:25 and SEQ ID NO:26:
[0071] ydzO-F:5'- tgaagcccgcctaatgagcgggcttttttctgataagaactgcaaaagctgcggatt at -3' (SEQ ID NO: 25),
[0072] ydzO-R:5'-ccaccctatagataaatttttcggctgccatat-3' (SEQ ID NO:26),
[0073] The gene sequences on both sides of the homology arms were amplified from the Bacillus subtilis genome using the above primers.
[0074] Using the plasmid p7S6P43 as a template, the primers whose sequences were SEQ ID NO:27 and SEQ ID NO:28 wer...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



