A kasp molecular marker, kit and application for identifying male sterility restoration gene of pepper cms
A molecular marker, gene recovery technology, applied in recombinant DNA technology, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of high cost, distinguish polymorphism, time-consuming, etc., to save manpower and accuracy high effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0077] Taking Chaotian pepper numbered PC324 as an example, 15 individual plants (among which, 5 were sterile, 3 were homozygous and fertile, and 7 were heterozygous and fertile) were selected from the F2 generation genetic segregation population as the experimental material for KASP markers. reliability test.
[0078] 1. Extract the total genomic DNA of the tested peppers by 2X CTAB method, measure the DNA concentration of the sample with Nanodrop, and adjust the final concentration of the sample DNA to 80-100ng / μL.
[0079] 2. Then construct a 5 μL PCR system: 2.5 μL of the sample DNA obtained in step 1, 0.07 μL of mixed primers with a concentration of 50 μM and 2.5 μL of 2x Mastermix; the mixed primers include the following three primers mixed in equal proportions:
[0080] Fluorescently labeled upstream primer F1 (SEQ ID NO. 4):
[0081] GAAGGTGACCAAGTTCATGCT AAGATCTGTGAGCCCAACGA
[0082] Fluorescently labeled upstream primer F2 (SEQ ID NO. 5):
[0083] GAAGGTCGGAGTCA...
Embodiment 2
[0089] Using the SNPline genotyping platform of LGC Company, 384 different types of pepper materials were selected as experimental materials to test the reliability of KASP markers.
[0090] 1. Extract the total genomic DNA of the tested peppers by 2X CTAB method, measure the DNA concentration of the sample with Nanodrop, and adjust the final concentration of the sample DNA to 80-100ng / μL;
[0091] 2. Construct a 5μL PCR system on the SNPline of LGC Company: it contains 2.5μL of the DNA to be tested obtained in step 1, 0.14μL of mixed primers with a concentration of 50μM and 5μL of 2x Master mix; the mixed primers include the following three primers mixed in equal proportions:
[0092] Fluorescently labeled upstream primer F1 (SEQ ID NO. 4):
[0093] GAAGGTGACCAAGTTCATGCT AAGATCTGTGAGCCCAACGA
[0094] Fluorescently labeled upstream primer F2 (SEQ ID NO. 5):
[0095] GAAGGTCGGAGTCAACGGATT AAGATCTGTGAGCCCAACGT
[0096] Downstream primer R (SEQ ID NO. 3):
[0097] SEQ ID ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

