LAMP primer combination for detecting 4 gram-negative bacteria in intraocular fluid and application thereof

A primer combination and primer set technology, applied in the biological field, can solve the problems of long PCR detection time, easy contamination, and application limitations

Inactive Publication Date: 2019-08-16
BEIJING CHAOYANG HOSPITAL CAPITAL MEDICAL UNIV
View PDF8 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, PCR has the disadvantages of long detection time, easy contamination, and high false positive rate, which limits its application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP primer combination for detecting 4 gram-negative bacteria in intraocular fluid and application thereof
  • LAMP primer combination for detecting 4 gram-negative bacteria in intraocular fluid and application thereof
  • LAMP primer combination for detecting 4 gram-negative bacteria in intraocular fluid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0133] Embodiment 1, the preparation of kit

[0134] The kit consists of four LAMP primer sets, each for the detection of 1 Gram-negative bacterium in intraocular fluid.

[0135] The primer set used to detect E. coli is as follows (5'→3'):

[0136] Outer primer F3 (SEQ ID NO: 1): GGCATCGTGGTGATTGATGA;

[0137] Outer primer B3 (SEQ ID NO: 2): GGTTCGTTGGCAATACTCCA;

[0138] Internal primer FIP (SEQ ID NO: 3): TCTTTCGGCTTGTTGCCCGCCTGCTGTCGGCTTTAACCTC;

[0139] Internal primer BIP (SEQ ID NO: 4): TACAGCGAAGAGGCAGTCAACGTTTTGGTTTTTGTCACGCGCTATC;

[0140] Loop primer LF (SEQ ID NO: 5): TTCGAAACCAATGCCTAAAGA;

[0141] Loop primer LB (SEQ ID NO: 6): GCGCACTTACAGGCGATT.

[0142] The primer set used to detect Pseudomonas aeruginosa is as follows (5'→3'):

[0143] Outer primer F3 (SEQ ID NO: 7): CAAggTgTTCATCCACgA;

[0144] Outer primer B3 (SEQ ID NO: 8): CgCTCCAgCgCTTTTCC;

[0145] Internal primer FIP (SEQ ID NO: 9): ACTCgTCgCCCATCTCgATggACTgAACgCCggTAACCA;

[0146] Internal pri...

Embodiment 2

[0164] Embodiment 2, specificity

[0165] Test sample 1: Escherichia coli.

[0166] Test sample 2: Pseudomonas aeruginosa.

[0167] Test sample 3: Klebsiella pneumoniae.

[0168] Test sample 4: Acinetobacter baumannii.

[0169] Each sample to be tested carries out the following steps respectively:

[0170] 1. Extract the genomic DNA of the sample to be tested.

[0171] 2. Using the genomic DNA extracted in step 1 as a template, each primer set prepared in Example 1 was used to perform loop-mediated isothermal amplification.

[0172] Reaction system (10 μL): 1 μL 10×ThermoPol Buffer, 1.6 μL betaine with a concentration of 5M, 0.1 μL BSA aqueous solution with a concentration of 50 mg / mL, and 0.4 μL MgSO with a concentration of 100 mM 4 Aqueous solution, 0.3 μL 20×EvaGreen, 0.15 μL of 100 mM dNTPs (each), 0.4 μL of 8 U / mL Bst DNA polymerase large fragment, genomic DNA of the sample to be tested (between 50 pg and 50 ng), 1 μL Primer mix, rehydrated to 10 μL. The primer mix...

Embodiment 3

[0181] Embodiment 3, sensitivity

[0182] Test sample 1: Escherichia coli.

[0183] Test sample 2: Pseudomonas aeruginosa.

[0184] Test sample 3: Klebsiella pneumoniae.

[0185] Test sample 4: Acinetobacter baumannii.

[0186] Each sample to be tested carries out the following steps respectively:

[0187] 1. Extract the genomic DNA of the sample to be tested, and perform gradient dilution with sterile water to obtain each dilution.

[0188] 2. Using the dilution obtained in step 1 as a template, the primer sets prepared in Example 1 were used to perform loop-mediated isothermal amplification.

[0189] When the sample to be tested is the sample to be tested 1, the loop-mediated isothermal amplification is performed using primer set I. When the sample to be tested is the sample to be tested 2, loop-mediated isothermal amplification is performed using primer set II. When the sample to be tested is the sample to be tested 3, loop-mediated isothermal amplification is perform...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP primer combination for detecting 4 gram-negative bacteria in intraocular fluid and an application thereof. The primer combination provided by the invention firstly is composed of 24 DNA molecules shown in a sequence 1 to 24. The primer combination can be applied for detecting whether to-be-tested bacteria are escherichia coli, pseudomonas aeruginosa, klebsiella pneumoniae or acinetobacter baumannii, and can be applied for detecting whether to-be-tested samples contain escherichia coli and / or pseudomonas aeruginosa and / or klebsiella pneumoniae and / or acinetobacter baumannii. The primer combination provided by the invention is used for detecting 4 gram-negative bacteria in the intraocular fluid, has high specificity and sensitivity, can realize simple, rapid and accurate detection, and has great promotion value.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a combination and application of LAMP primers for detecting four kinds of Gram-negative bacteria in intraocular fluid. Background technique [0002] Bacteria are the main pathogenic bacteria of exogenous endophthalmitis, Escherichia coli (Escherichia coli), Pseudomonas aeruginosa (P. The main 4 Gram-negative bacteria that cause endophthalmitis. Escherichia coli was discovered by Escherich in 1885. For a long period of time, it has been regarded as a part of normal intestinal flora and considered to be non-pathogenic bacteria. It was not until the middle of the 20th century that some special serotypes were recognized. Escherichia coli is pathogenic to humans and animals, and is the most dominant and most abundant bacterium in the intestinal tract of humans and many animals. Pseudomonas aeruginosa, formerly known as Pseudomonas aeruginosa, is a common conditional pathogen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12Q1/10C12Q1/04
CPCC12Q1/6844C12Q1/689C12Q2531/119C12Q2537/1376
Inventor陶勇
OwnerBEIJING CHAOYANG HOSPITAL CAPITAL MEDICAL UNIV