Double primer and its application
A dual-primer and product technology, which is applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problem of high cost of full-length sequencing
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0076] Identification of embodiment 1 circular DNA / RNA
[0077] according to figure 2 Based on the principle of using circular DNA / RNA with a size of 1467bp as a template to design double primers, the double primers are dispersed primers, and the distance between the 3' ends of the first primer and the second primer in the double primers is 200bp, and the specific sequence as follows:
[0078] First primer (SEQ ID NO.1): GGCTTCAAGTGGGAGAGATTCA
[0079] Second primer (SEQ ID NO.2): GGATGTCGGCAGGGTGTTTA
[0080] The designed double primers are used for the identification of circular DNA / RNA, the specific steps are as follows:
[0081] 1) Primer and template annealing complementary reaction
[0082] The primers anneal to the template strand and complement each other, and the specific reaction system is shown in Table 1 below:
[0083] Table 1
[0084]
[0085]
[0086] Carry out PCR reaction, specific conditions: 95°C for 3min, 4°C for more than 2min;
[0087] 2) Ro...
Embodiment 2
[0106] Compared with Example 1, the only difference is that the amount of restriction endonuclease is 0.5U, and other reagents and methods are the same as in Example 1.
Embodiment 3
[0108] Compared with Example 1, the only difference is that the amount of restriction endonuclease is 1 U, and other reagents and methods are the same as in Example 1.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



