Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for producing L-lysine by fermentation of bacteria capable of changing ppc gene

A lysine and gene technology, applied in the field of amino acid fermentation, can solve the problems of unpredictable protein activity, little interest, unpredictable influence of L-lysine production, etc., and achieve the effect of facilitating popularization and application and improving yield

Active Publication Date: 2019-09-03
HEILONGJIANG EPPEN BIOTECH CO LTD
View PDF10 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] reported in existing literature ppc (phosphoenolpyruvate carboxylase, phosphoenolpyruvatecarboxylase) gene and its encoded protein increase, decrease or mutation, etc. are used in the production of amino acids (including L-lysine), for example, WO0100844A2, WO2005058945A2, EP0358940A1 and JP1998165180A, etc., However, the protein activity after mutation is unpredictable, and accordingly, its influence on L-lysine production is also unpredictable, especially, in the past ten years, on ppc New studies of the effect of mutations in the gene and its encoded protein on L-lysine production have dwindled, suggesting researchers are unsure whether there is a new ppc There has been less and less interest in mutations of the gene and its encoded protein to improve L-lysine production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing L-lysine by fermentation of bacteria capable of changing ppc gene
  • Method for producing L-lysine by fermentation of bacteria capable of changing ppc gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 contains point deletion NCgl1523 Construction of gene promoter transformation vector pK18-NCgl1523

[0038] According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of amplification were synthesized NCgl1523 Gene promoter region fragment (the nucleotide sequence including the promoter and coding region is shown as the complementary sequence of SEQ ID NO: 5, or it can be accessed at https: / / www.ncbi.nlm.nih.gov / gene / *term =NCgl1523) primers to replace the wild type on the chromosome of strain YPL-4 by allelic replacement NCgl1523 One base is knocked out at position -1 of the promoter region of the gene (the nucleotide sequence including the promoter and the coding region is shown as the complementary sequence of SEQ ID NO: 6). Primers were designed as follows (synthesized by Shanghai Invitrogen Company):

[0039] P1': 5' CCGGAATTC GTGATGCGACGGCGGATGT 3' (EcoR I)

[0040] P2': 5' CTCAATGTGAAAGAGTGTTTAAAGTAGTTAA...

Embodiment 2

[0044] Example 2 contains point deletion NCgl1523 Construction of strains with gene promoters

[0045] The plasmid pK18-NCgl1523 obtained in Example 1 was electrotransformed into the lysine producing bacterium (Corynebacterium glutamicum) patent strain YPL-4 (namely YP97136) (for its construction method, please refer to WO2014121669A1; it was confirmed by sequencing that the strain on the chromosome wild-type NCgl1523 Genes and their promoters), the single colonies produced by culture were identified by primers P1' / M13F, and the strains that could amplify a band with a size of 1100bp were positive strains. The positive strains were cultured on a medium containing 12% sucrose, and the single colony produced by the culture was cultured on a medium containing kanamycin and a medium without kanamycin, respectively, and cultured on a medium without kanamycin The strains that grow on culture medium but do not grow on medium containing kanamycin are further identified by PCR usin...

Embodiment 3

[0049] Example 3 Contains point mutations NCgl1523 Gene transformation vector pK18-NCgl1523 A482V build

[0050] According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of amplification were synthesized NCgl1523 A primer for the fragment of the gene coding region (its nucleotide sequence is shown in the complementary sequence of SEQ ID NO: 1, and the encoded amino acid sequence is shown in SEQ ID NO: 3), so as to replace alleles in bacterial strain YPL-4 wild type on chromosome NCgl1523 A482V point mutation is introduced into the coding region of the gene (the nucleotide sequence is shown in the complementary sequence of SEQ ID NO: 2, and the encoded amino acid sequence is shown in SEQ ID NO: 4). Primers were designed as follows (synthesized by Shanghai Invitrogen Company):

[0051] P1: 5' CGC GGATCC CCTGGGCTGGGCAAGAATC 3' (BamH I)

[0052] P2: 5' CCGAATTTCTTAACAACCTCCGACGCGGTG 3'

[0053] P3: 5' CACCGCGTCGGAGGTTGTTA AGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a method for producing L-lysine by fermentation, which comprises modifying a wild-type ppc gene on the corynebacterium glutamicum chromosome; and fermenting the L-lysinewith the modified corynebacterium glutamicum. In addition, the present invention also provides a method and use derived by the method of the invention, as well as corynebacterium glutamicum, polynucleotides and the like which can be used in such methods and use.

Description

technical field [0001] The present invention belongs to the field of amino acid fermentation, and in particular, the present invention relates to a method for producing L-lysine by fermentation, a method and application of its derivation, and bacteria that can be used in these methods and applications. Background technique [0002] Production of L-lysine by fermentation of L-lysine-producing bacteria (eg, Escherichia coli of the genus Escherichia and rod-shaped bacteria of the genus Corynebacterium) has been industrially applied. These bacteria can be bacteria isolated from nature, bacteria obtained through mutagenesis or genetic engineering, or both. [0003] reported in existing literature ppc (phosphoenolpyruvate carboxylase, phosphoenolpyruvatecarboxylase) gene and its encoded protein increase, decrease or mutation, etc. are used in the production of amino acids (including L-lysine), for example, WO0100844A2, WO2005058945A2, EP0358940A1 and JP1998165180A, etc., Howev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P13/08C12N1/21C12N15/77C12N9/88C12N15/60C12R1/15
CPCC12N9/88C12P13/08C12Y401/01031
Inventor 周晓群孟刚魏爱英苏厚波马风勇赵春光
Owner HEILONGJIANG EPPEN BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com