Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Antigen used for early diagnosis of haemonchus contortus infection, and application thereof

A technology for early diagnosis of Haemonchus contortus, which is applied in the field of veterinary biotechnology and molecular biology, can solve the problem of no antigen, and achieve the effect of economical convenience, good application prospect and simple operation

Active Publication Date: 2019-09-10
NANJING AGRICULTURAL UNIVERSITY
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, there is no report on ELISA antigens for early diagnosis of Haemonchus contortus infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antigen used for early diagnosis of haemonchus contortus infection, and application thereof
  • Antigen used for early diagnosis of haemonchus contortus infection, and application thereof
  • Antigen used for early diagnosis of haemonchus contortus infection, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Healthy goats were artificially infected with 8,000 third-stage larvae of Haemonchus contortus, and anticoagulant blood was taken from the goats on the 7th, 15th, 40th, and 60th days after infection, and goat peripheral blood mononuclear cells (PBMCs) were isolated, and immunocoagulation Precipitation technology and mass spectrometry analysis showed that more than 400 kinds of proteins excreted and secreted by Haemonchus contortus can be combined with PBMC of goats, and ADRM protein is one of them, and this protein appeared on the 7th day after the worm infected goats host blood, indicating that ADRM has potential early diagnostic value.

Embodiment 2

[0052] The total RNA of Haemonchus contortus adults was extracted, and cDNA templates were synthesized, using Hc-ADRM-F: CCgaattcATGTTTTTCTACATCCCGCTCTTCTC (EcoRI, SEQ ID NO.3) and Hc-ADRM-R: ATctcgag TTAGCAGCCGGATCTCAGTG (XhoⅠ, SEQ ID NO.4) as The Hc-ADRM fragment was amplified by PCR with primers, and the obtained HcADRM fragment and the prokaryotic expression plasmid pET-28a were digested, then connected, transformed and identified as positive clones, and sent to GenScript Biotechnology Co., Ltd. for sequencing. The nucleotide sequence of the HC-ADRM antigen is shown in SEQ ID NO.2.

Embodiment 3

[0053] Expression of embodiment 3 antigen rHC-ADRM

[0054] The Hc-ABHD positive clones with correct sequencing were inoculated in 1 L of liquid LB medium containing kanamycin (100 μg / mL) at a ratio of 1:100. When cultured at 37° C. with shaking at 180 rpm to the logarithmic phase (OD600 is about 0.6), IPTG (working concentration: 1 mM) was added. Continue to cultivate for 5h. After induction of expression, centrifuge at 8000 rpm for 10 min at low temperature, and discard the supernatant. After washing the cells with PBS for 2 times, resuspend with the supernatant Binding buffer, freeze and thaw repeatedly 2-3 times, and disrupt the cells by ultrasonic. The sonicated lysate was centrifuged at 4°C and 8000 rpm for 15 min, and the supernatant was collected. The precipitate was dissolved overnight at 4°C with 30-40mL inclusion body Binding buffer. The SDS-PAGE electrophoresis analysis of the supernatant and precipitated samples confirmed that the expression of the recombinant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an antigen used for the early diagnosis of haemonchus contortus infection, and application thereof. The invention authenticates an antigen used for parasite infection, and theamino acid sequence of the antigen is disclosed in SEQ ID NO.1. The antigen can be used for carrying out specific recognition on an antibody in the serum of a host infected with the haemonchus contortus for 14 days, a definite diagnosis is made before 4-6 days of ovum ovulation, and the pollution of the ovum for the environment and a pasture can be avoided so as to perform an important meaning for the prevention and control of the haemonchus contortus disease. By use of the antigen disclosed by the invention, the antigen is used for establishing an indirect ELISA (Enzyme Linked ImmunosorbentAssay) detection method, and therefore, the antigen has the advantages of being high in sensitivity, good in specificity, simple in operation, high in diagnosis speed, economic, convenient and the like during large-scale detection, and has a good application prospect in the diagnosis, the prevention and the curing of the haemonchus contortus disease of ruminants, including cows, goats, deer, camels and the like.

Description

technical field [0001] The invention belongs to the technical fields of veterinary biotechnology and molecular biology, and relates to an antigen for early diagnosis of Haemonchus contortus infection and application thereof. Background technique [0002] Haemonchus contortus is an important digestive parasite of ruminants such as cattle, sheep, camels and deer. It feeds on the blood of the host and causes anemia and anemia syndrome in animals, especially lambs Death, the mortality rate is as high as 30%. The disease is distributed worldwide and has been reported all over the country, and the infection rate of flocks in some pastoral areas is even as high as 70-80%. With the vigorous development of herbivorous animals such as cattle and sheep and related industries in my country, the harm of Haemonchus contortus and the economic losses caused by it have become increasingly obvious and serious. [0003] The parasite has a simple life cycle, and ruminants such as cattle and s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/543
CPCG01N33/543G01N2333/4353
Inventor 严若峰李祥瑞徐立新宋小凯卡力比夏提.艾木拉江陆明敏
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com