A kind of erbb2 single-chain antibody, chimeric antigen receptor targeting human erbb2, recombinant vector, recombinant cell and application

A technology of chimeric antigen receptors and single-chain antibodies, which is applied in the field of tumor immunobiological therapy, can solve the problems of unsustainable killing of tumor cells and large toxic and side effects, and achieve the ability of lasting multiple times of killing tumor cells and the release of cytokines Mild reaction, good continuous killing effect

Active Publication Date: 2020-07-10
BEIJING DCTY BIOTECH CO LTD +1
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current CAR-NK cells have high toxicity and side effects, and the effect of killing tumor cells is not long-lasting

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of erbb2 single-chain antibody, chimeric antigen receptor targeting human erbb2, recombinant vector, recombinant cell and application
  • A kind of erbb2 single-chain antibody, chimeric antigen receptor targeting human erbb2, recombinant vector, recombinant cell and application
  • A kind of erbb2 single-chain antibody, chimeric antigen receptor targeting human erbb2, recombinant vector, recombinant cell and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Preparation of ErbB2 Monoclonal Antibody 19G9

[0045] S1, synthetic ErbB2-Domain4 gene

[0046] The nucleotide sequence of the ErbB2-Domain4 gene is as follows:

[0047] atggagctggcggccttgtgccgctgggggctcctcctcgccctcttgccccccggagccgcgagcacctgccaccagctgtgcgcccgagggcactgctggggtccagggcccacccagtgtgtcaactgcagccagttccttcggggccaggagtgcgtggaggaatgccgagtactgcaggggctccccagggagtatgtgaatgccaggcactgtttgccgtgccaccctgagtgtcagccccagaatggctcagtgacctgttttggaccggaggctgaccagtgtgtggcctgtgcccactataaggaccctcccttctgcgtggcccgctgccccagcggtgtgaaacctgacctctcctacatgcccatctggaagtttccagatgaggagggcgcatgccagccttgccccatcaactgcacccactcctgtgtggacctggatgacaagggctgccccgccgagcagagagccagccctctgacgtccatcatctctgcggtggttggcattctgctggtcgtggtcttgggggtggtctttgggatcctcatc(SEQ ID No.21)

[0048] During the synthesis process, restriction endonucleases NdeI and XhoI were respectively added to the upstream and downstream of the ErbB2-Domain4 gene to obtain the ErbB2-Domain4 gene insertion fragment.

[0049] Expression ...

Embodiment 2

[0081] Preparation of recombinant vector

[0082] Arranging the expression sequence as GM-CSF signal peptide-19G9 single chain antibody region-CD8 transmembrane region-CD28 intracellular region-4-1BB intracellular region-CD3ζ intracellular region (GM-CSF signal peptide-19G9 ScFv-CD8TM-41BBcyto -CD28cyto-CD3ζ) form. Each fragment sequence is:

[0083] GM-CSF signal peptide (SEQ ID No.16)

[0084] cttctcctggtgacaagccttctgctctgtgagttaccacacccagcattcctcctgatccca

[0085] 19G9 single chain antibody region (SEQ ID No.2)

[0086] ctggagcagtcaggccctgggatattgcagccctcccagaccctcagtttgatctgttctttctctgggttttcactgagtacttctggtatgggtgtaagctggattcgccagccttcaggaaagggtctggagtggctggcacacatttactgggatgatgacaagcgctataacccatccctgaagagccggctcacaatctccaaggatacctccagcaagcaggttttcctcaagatcaccagtgttgacactgcagatactgccacatactactgtgctctcttcgcctactataactacgacgggactgtggactactggggtctaggaacctcagtcaccgtctcctcaggcggaggcggatcaggtggtggcggatctggaggtggcggaagcgacattgtgatgacacagactccatcctccctggctgtgtcagtaggagagaaggtc...

Embodiment 3

[0097] Preparation of recombinant cells

[0098] The packaged virus in Example 2 was used to infect NK92 cells (purchased from ATCC) at an MOI (multiplicity of infection) of 100:1. The infected NK92 cells were amplified and cultured in LY09 medium, and after 72 hours of culture, cells positive for the copGFP reporter gene (green fluorescence) were sorted by flow cytometry. At this time, the recombinant cell 19G9 CAR-NK was obtained. The results of flow cytometry analysis of GFP expression in 19G9 CAR-NK cells and wild-type NK92 cells after sorting were as follows: image 3 As shown, the expression level of GFP in 19G9 CAR-NK cells is high, while the expression level of GFP in wild-type NK92 cells is zero.

[0099] The specific binding of ErbB2 protein to 19G9 CAR-NK cells was analyzed by flow cytometry. Take 1 μg of ErbB2-biotin (Acro) protein and incubate with 1,000,000 19G9 CAR-NK cells and 1,000,000 NK92 cells for 30 minutes respectively, add Pacific Blue-labeled strepta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an ErbB2 single-chain antibody, a chimeric antigen receptor targeting human ErbB2, a recombinant vector, a recombinant cell and an application, belonging to the technical field of tumor immunotherapy. The ErbB2 single-chain antibody has the characteristics of SEQ ID No. The amino acid sequence shown in .1; the chimeric antigen receptor targeting human ErbB2 has the amino acid sequence shown in SEQ ID No. 3; the recombinant vector includes a gene encoding the chimeric antigen receptor and Initial vector; the recombinant cells include natural killer cells and the recombinant vector. The ErbB2 single chain antibody of the present invention can specifically recognize tumor antigens, avoid the off-target effect of CAR-NK cells, and have a good tumor cell killing effect; the recombinant cells have a high ability to continuously kill tumor cells and reduce Risk of cytokine storm.

Description

technical field [0001] The invention belongs to the technical field of tumor immune biotherapy, and in particular relates to an ErbB2 single-chain antibody, a chimeric antigen receptor targeting human ErbB2, a recombinant vector, a recombinant cell and applications. Background technique [0002] Traditional tumor treatment methods mainly include surgery, radiation therapy, chemotherapy, and stem cell transplantation, which has emerged in recent years, and these treatments are often palliative, not the root cause. With the development of science, great breakthroughs have been achieved in tumor immunotherapy in recent years, mainly including immune checkpoint inhibitors (such as anti-PD1 monoclonal antibody), and chimeric antigen receptor T cell immunotherapy (Chimeric Antigen Receptor Modified T cell therapy, CAR-T). In recent years, CAR-T technology has made encouraging progress in clinical trials for the treatment of blood diseases, and was named the top ten scientific bre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K16/32C07K19/00C12N15/13C12N15/62C12N15/867C12N5/10A61K39/00A61P35/00
CPCC07K16/32C07K14/7051C12N15/86C12N5/0646A61P35/00C07K2317/35C07K2317/56C07K2317/622C07K2317/92C07K2319/02C07K2319/03C07K2319/33C12N2510/00C12N2740/15043A61K39/464406A61K39/4613A61K39/4631C07K16/2863A61K39/395C07K2317/76C12N2740/16043
Inventor焦顺昌张嵘袁翰
OwnerBEIJING DCTY BIOTECH CO LTD