A fusion protein, base editing tool and method and application thereof

A fusion protein and gene editing technology, applied in the field of gene editing, can solve the problems of limiting the scope of genome targeting and achieve the effect of broadening the scope of targeting

Active Publication Date: 2021-04-23
GUANGZHOU UNIVERSITY
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Cas9 (SpCas9) from Streptococcus pyogenes only recognizes the PAM of the NGG sequence, greatly limiting the extent of the genome that can be targeted

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A fusion protein, base editing tool and method and application thereof
  • A fusion protein, base editing tool and method and application thereof
  • A fusion protein, base editing tool and method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0105] First construct ancBE4max-NG and ABEmax-NG plasmids, and introduce 7 amino acid mutations (R1335V / L1111R / D1135V / G1218R / E1219F / A1322R / T1337R) into ancBE4max and ABEmax plasmids through Mut Express II FastMutagenesis Kit V2 (Vazyme, C214-02) , ancBE4max was synthesized from the whole gene by a commercial company, and the ABEmax plasmid was purchased from Addgene (#112095). The DNA sequence contained in the generated pCMV-ancBE4max-NG is shown in SEQ ID No.17; the DNA sequence contained in pCMV-ABEmax-NG is shown in SEQ ID No.18.

Embodiment 2

[0107] On the basis of embodiment 1 gained ancBE4max-NG and ABEmax-NG, construct as figure 1 and 2 Indicated pAAV-TRE-ancBE4max-NG 2-573-intein-N, pAAV-TRE-intein C-ancBE4max-NG 574-1368, pAAV-TRE-ABEmax-NG 2-573-intein-N, pAAV-TRE -intein C-ABEmax-NG 574-1368.

[0108]2.1 pAAV-TRE-ancBE4max-NG-2-573-intein-N, pAAV-TRE-intein C-ancBE4max-NG-574-1368, pAAV-TRE-ABEmax-NG-2-573-intein-N, pAAV- Construction of TRE-intein C-ABEmax-NG574-1368 plasmid

[0109] The PCR primers whose sequences are shown in Table 1 were synthesized by Jinweizhi Biotechnology Co., Ltd., diluted to 10 μM as PCR primers, and the original pAAV-TRE was used as a template.

[0110] Table 1

[0111] N-AAV-For TGCCTGGCCGGCGACACCCTG N-AAV-Rev CATaagcttAGCGTAATCTGGAACG N-ancBE4max-For GATTACGCTaagcttATGagcagtgaaaccggaccagtg N-ancBE4max-Rev TGTCGCCGGCCAGGCActcgattttcttgaagtagtc N-ABEmax-For GATTACGCTaagcttATGtctgaagtcgagtttagcca N-ABEmax-Rev TGTCGCCG...

Embodiment 3

[0123] Using the N-ancBE4max-NG+C-anc-BE4max-NG and N-ABEmax-NG+C-ABEmax-NG systems constructed in the above examples to transfect HEK293T cells, the process is as follows:

[0124] 3.1 HEK293T cells (from ATCC) were revived and cultured in a 10 cm culture dish (Corning, 430167). The medium was DMEM (HyClone, SH30243.01) mixed with 10% fetal bovine serum (HyClone, SV30087). The culture temperature was 37°C, and the carbon dioxide concentration was 5%. After multiple passages, when the cell density was 80%, the cells were divided into 12-well plates. The 12-well plate was coated with a 1:10 diluted polylysine solution (Sigma, P4707-50ML) before use.

[0125] 3.2 When the cell concentration is 80%, replace the medium with DMEM medium with 10% serum, and culture for 2 hours to restore the best cell state. The amount of plasmid transfected per well is N-ancBE4max-NG 0.5ug, C-anc-BE4max-NG 0.5ug, sgRNA 0.5ug or N-ABEmax-NG 0.5ug, C-ABEmax-NG 0.5ug, sgRNA 0.5 ug co-transfected 29...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene editing tool, the editing tool is N-ABEmax-NG+C-ABEmax-NG editing system for converting base A to G, and the editing system includes fusion protein, sgRNA and sgRNA packaging carrier , and the adenovirus packaging system. The gene editing tool of the present invention can recognize NG as PAM, which broadens the target range of base editing, and the base editing tool of the present invention can be applied to the packaging requirements of adenovirus.

Description

technical field [0001] The invention relates to the technical field of gene editing, in particular to an adenovirus-based base editing tool and method and its application. Background technique [0002] Gene editing is a technical means to achieve gene sequence changes or insertions by introducing sequence changes at specific sites on DNA. CRISPR / Cas9 is currently the most widely used gene editing technology 1 . The system is simple to operate, and only needs to pass the sgRNA targeting sequence to perform gene editing at the target site. This technology is widely used in gene function research, disease simulation, and gene therapy. The principle of CRISPR / Cas9 is that under the guidance of sgRNA, Cas9 reaches the designated DNA region to exert enzyme cleavage activity. The targeted recognition of the CRISPR / Cas9 system requires a protospacer adjacent motif (PAM) next to the target site. Then cut between 3bp and 4bp upstream of the PAM, resulting in a DNA double-strand bre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K19/00C12N15/861C12N5/10
CPCC07K14/775C07K2319/09C12N9/22C12N15/86C12N2710/10043
Inventor乔云波
OwnerGUANGZHOU UNIVERSITY