Check patentability & draft patents in minutes with Patsnap Eureka AI!

dsRNA designed based on Periplaneta americana Dsx gene, and preparation method, coding gene and application of dsRNA

A technology of Periplaneta americana and gene, applied in the field of dsRNA and its preparation, can solve the problems of strong drug resistance, fast reproduction speed of Periplaneta americana, etc., and achieve high specificity effect

Active Publication Date: 2019-12-10
GUANGMEIYUAN R & D CENT KEY LAB OF INSECT DEVELOPMENTAL BIOLOGY & APPL TECH SOUTH CHINA NORMAL UNIV MEIZHOU +1
View PDF6 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

By using Dsx as a target to control the reproduction of female Periplaneta americana, and then achieve the purpose of pest control, it will be expected to solve the problems of fast reproduction speed and strong drug resistance of Periplaneta americana in the prior art. However, in the prior art There is no relevant report yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • dsRNA designed based on Periplaneta americana Dsx gene, and preparation method, coding gene and application of dsRNA
  • dsRNA designed based on Periplaneta americana Dsx gene, and preparation method, coding gene and application of dsRNA
  • dsRNA designed based on Periplaneta americana Dsx gene, and preparation method, coding gene and application of dsRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0040] In order to describe the technical content, structural features, achieved goals and effects of the present invention in detail, the following will be described in detail in conjunction with the embodiments and accompanying drawings.

[0041] Example 1 of the present invention is: a dsRNA designed based on the Periplaneta americana Dsx gene, the sense strand sequence of the nucleotides of the dsRNA is shown in Seq ID No.1, and the antisense strand is shown in Seq ID No.1 The nucleotide sequence of reverse complementary sequence, the nucleotide sequence shown in Seq ID No.1 is specifically as follows:

[0042] CGCCCGCUGUAGGAACCACCGCCUCAAGAUAGGCCUCAAGGGCCACAAGCGCUACUGCAAGUACCGGUACUGCAACUGCGACAAGUGCUGUCUGACGGCG.

[0043] Its preparation process comprises the following steps:

[0044] (1) Primer design

[0045] According to the Dsx gene sequence (as shown in SEQ ID No.2) in the American cockroach genome database, its highly conserved region fragment (as shown in SEQ ID No....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses dsRNA designed based on a Periplaneta americana Dsx gene, and a preparation method, coding gene and application of the dsRNA. The dsRNA is double-strand RNA consisting of a nucleotide sequence as shown in Seq ID No.1 as a positive-sense strand and a backward complementary nucleotide sequence as shown in Seq ID No.1 as an antisense strand. The dsRNA can be widely applied topreparation of products for controlling periplaneta americana, interfering chemical communication of the periplaneta americana or controlling reproduction of female adult insects of the periplaneta americana or controlling periplaneta americana and other insects having the same gene target sequence. Gene Dsx is used as a target through insect sex, and based on a genetic fragment in the Dsx, the dsRNA is designed. The dsRNA is imported into the bodies of the adult female periplaneta americana, ova can be prevented from generating, and ovaries can be prevented from being mature, so that the reproduction of the female periplaneta americana can be controlled, and the purpose of pest control can be achieved.

Description

technical field [0001] The invention relates to the field of sanitation pest control, in particular to dsRNA designed based on the Periplaneta americana Dsx gene, its preparation method, coding gene and application. Background technique [0002] In 1965, a recessive mutation that made the male and female development of offspring intersex was discovered in Drosophila, and this mutant was called doublesex (Dsx) [1] . Studies have shown that the Dsx gene produces a male and a female-specific DSX protein through sex-specific alternative splicing of its transcripts, exerting its bifunctional role in somatic sexual differentiation, thereby regulating downstream related sex-specific traits target gene [2] . Dsx was once thought to be the final master regulatory gene in the sex determination cascade of all insects, however, later studies refuted this claim and considered it a central link between sex determination and sex differentiation [3] . Dsx homologous genes have differen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113A01N57/16A01P7/04
CPCA01N57/16C12N15/113C12N2310/14
Inventor 李胜朱仕明
Owner GUANGMEIYUAN R & D CENT KEY LAB OF INSECT DEVELOPMENTAL BIOLOGY & APPL TECH SOUTH CHINA NORMAL UNIV MEIZHOU
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More