dsRNA designed based on Periplaneta americana Dsx gene, and preparation method, coding gene and application of dsRNA
A technology of Periplaneta americana and gene, applied in the field of dsRNA and its preparation, can solve the problems of strong drug resistance, fast reproduction speed of Periplaneta americana, etc., and achieve high specificity effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0040] In order to describe the technical content, structural features, achieved goals and effects of the present invention in detail, the following will be described in detail in conjunction with the embodiments and accompanying drawings.
[0041] Example 1 of the present invention is: a dsRNA designed based on the Periplaneta americana Dsx gene, the sense strand sequence of the nucleotides of the dsRNA is shown in Seq ID No.1, and the antisense strand is shown in Seq ID No.1 The nucleotide sequence of reverse complementary sequence, the nucleotide sequence shown in Seq ID No.1 is specifically as follows:
[0042] CGCCCGCUGUAGGAACCACCGCCUCAAGAUAGGCCUCAAGGGCCACAAGCGCUACUGCAAGUACCGGUACUGCAACUGCGACAAGUGCUGUCUGACGGCG.
[0043] Its preparation process comprises the following steps:
[0044] (1) Primer design
[0045] According to the Dsx gene sequence (as shown in SEQ ID No.2) in the American cockroach genome database, its highly conserved region fragment (as shown in SEQ ID No....
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com