Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Double-cut donor for hemophilia A and medicine combination thereof

A technology for hemophilia and donors, applied in drug combination, introduction of foreign genetic material using vectors, blood diseases, etc., can solve problems such as inability to achieve treatment, achieve long-term stability, continuous treatment, and improve gene insertion efficiency. Effect

Active Publication Date: 2019-12-31
INST OF HEMATOLOGY & BLOOD DISEASES HOSPITAL CHINESE ACADEMY OF MEDICAL SCI & PEKING UNION MEDICAL COLLEGE
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since F8 is mainly expressed by endothelial cells rather than hepatocytes 13 , so in situ correction of F8 in hepatocytes cannot achieve therapeutic purposes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double-cut donor for hemophilia A and medicine combination thereof
  • Double-cut donor for hemophilia A and medicine combination thereof
  • Double-cut donor for hemophilia A and medicine combination thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0041] In order to better understand the present invention, the present invention will be described in detail below in conjunction with specific drawings.

[0042] 1. Experimental method

[0043] 1.01 Cas9-sgRNA plasmid construction

[0044] We designed sgAlb (GTTGTGATGTGTTTAGGCTA) targeting the Alb stop codon using the CHOPCHOP website (https: / / chopchop.rc.fas.harvard.edu / ). The sgAlb was cloned into the pU6-sgRNA vector using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs), and verified by Sanger sequencing (MCLAB) to obtain the pU6-sgAlb vector. The pEF1-Cas9 vector can use the published pEF1-Cas9-Wpre-PolyA.

[0045] 1.02 Donor plasmid construction

[0046] To construct the pDonor plasmid targeting the Alb stop codon, we amplified the left and right homology arms from mouse genomic DNA, removed the stop codon, and ligated to the E2A sequence; and PCR amplified the insert from other vectors tdTomato, BDDF8, F8 or mNeonGreen. The sgAlb target sequence and the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a double-cut donor for hemophilia A. BDDF8 is located at a highly expressed Alb site in liver cells, sgAlb-PAM sequences capable of being recognized by Cas9-sgAlb are also arranged on both sides of a homologous arm, after high-pressure tail vein injection of a novel double-cut HDR donor plasmid encoding Cas9, sgAlb and pDonor plasmids, 1-2% of liver cells accuratelyintegrate BDDF8 at the Alb site. In addition, a combined use of an immunosuppressant enables the BDDF8 to be stably expressed in lifetime in 80% or more of mice, indicating that hemophilia A is completely cured in most mice.

Description

technical field [0001] The present invention relates to a CRISPR-Cas9-mediated gene editing technique for inserting high expression of F8 gene into hepatic cells, and a method for improving the stability of F8 activity by using it in combination with immunosuppressants. Background technique [0002] Hemophilia A (HA) is one of the most common genetic disorders affecting 1 in 5,000 male births in the United States, accounting for approximately 85% of hemophiliacs 1 . HA is caused by mutations in the gene encoding coagulation factor VIII (F8) on the X chromosome. Recombinant F8 protein has been widely used to treat HA patients, but this results in 20-30% of patients developing inhibitory neutralizing antibodies, limiting the therapeutic effect 2 . [0003] Adeno-associated virus (AAV)-based gene therapy for hemophilia B (F9 mutation) has made remarkable progress, and infusion of AAV vector expressing factor IX Padua (F9-r338l) successfully achieved sustained expression of F...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/65C12N15/12A61K31/7105A61K48/00A61K31/675A61K31/573A61P7/04
CPCC12N15/85C12N15/65C07K14/47A61K31/7105A61K31/675A61K31/573A61P7/04C12N2830/48A61K2300/00
Inventor 程涛张健萍程新新赵梅李国华许静张凤张孝兵
Owner INST OF HEMATOLOGY & BLOOD DISEASES HOSPITAL CHINESE ACADEMY OF MEDICAL SCI & PEKING UNION MEDICAL COLLEGE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com