Double-cut donor for hemophilia A and medicine combination thereof
A technology for hemophilia and donors, applied in drug combination, introduction of foreign genetic material using vectors, blood diseases, etc., can solve problems such as inability to achieve treatment, achieve long-term stability, continuous treatment, and improve gene insertion efficiency. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0041] In order to better understand the present invention, the present invention will be described in detail below in conjunction with specific drawings.
[0042] 1. Experimental method
[0043] 1.01 Cas9-sgRNA plasmid construction
[0044] We designed sgAlb (GTTGTGATGTGTTTAGGCTA) targeting the Alb stop codon using the CHOPCHOP website (https: / / chopchop.rc.fas.harvard.edu / ). The sgAlb was cloned into the pU6-sgRNA vector using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs), and verified by Sanger sequencing (MCLAB) to obtain the pU6-sgAlb vector. The pEF1-Cas9 vector can use the published pEF1-Cas9-Wpre-PolyA.
[0045] 1.02 Donor plasmid construction
[0046] To construct the pDonor plasmid targeting the Alb stop codon, we amplified the left and right homology arms from mouse genomic DNA, removed the stop codon, and ligated to the E2A sequence; and PCR amplified the insert from other vectors tdTomato, BDDF8, F8 or mNeonGreen. The sgAlb target sequence and the ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap