Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Medicine for treating lung cancer

A drug and lung cancer technology, applied in the field of biomedicine, can solve the problem of lack of effective treatment for lung cancer

Active Publication Date: 2020-01-10
JINAN UNIVERSITY
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current treatment for this type of lung cancer, even for lung cancers that also carry KRAS mutations, lacks effective treatments.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Medicine for treating lung cancer
  • Medicine for treating lung cancer
  • Medicine for treating lung cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] CLU-knockdown lung cancer cells are more sensitive to TAK1 inhibitor NG25

[0028] 1. Experimental method

[0029] (1) Hop62 cell construction CLU stable knockdown cell line construction: first, the expression vector pLKO.1-shCLU (Sigma, TRCN0000078611, sequence: CCGGGCTAAAGTCCTACCAGTGGAACTCGAGTTCCACTGGTAGGACTTTAGCTTTTTG) and the viral backbone vector psPAX and PM2.G were co-transfected into 293T cells for lentiviral packaging , pLKO.1-shGFP (Sigma, SHC004) vector was used as a control. Hop62 cells were infected with packaged shCLU and shGFP viruses, and then 2ug / mL Puromycin was used to screen for cell lines that stably knocked down CLU. The knockdown effect of cell lines was evaluated by immunoblotting.

[0030] (2) Detect the sensitivity of Hop62-shCLU cells to NG25 by the method of CCK8: add Hop62-shGFP and Hop62-shCLU cells (800cell / well) into 96-well plates respectively, and then use 0, 0.01625, 0.3125, 0.625, NG25 at concentrations of 1.25, 2.5, 5 and 10 μM wa...

Embodiment 2

[0037] NG25 and Trametinib can significantly inhibit the growth of lung cancer cells with CLU downregulation

[0038] 1. Experimental method

[0039] (1) Inoculate Hop62-shCLU cells in a 96-well plate, 800 cells per well, and then use four kinds of DMSO (control), NG25 (1.25μM), Trametinib (Tram, 25nM) and NG25 combined with Tram (1.25μM+25nM) respectively way to process cells. The growth activity of the cells was detected by CCK8 every day, and the growth curve of the cells was drawn after 6 days.

[0040] (2) Plate colony formation to evaluate the effect of NG25 combined with Tram on cell growth: 400 cells / well were inoculated in a 6-well plate, and DMSO (control), NG25 (1.25 μM), Tram (25 nM) and NG25 combined with Tram (1.25 μM+ 25nM) to treat cells in four ways. After 7 days of culture, cells were fixed, stained, and statistically analyzed.

[0041] 2. Experimental results and analysis

[0042] (1) In the cell growth test, compared with the DMSO group, NG25 slightly ...

Embodiment 3

[0045] NG25 combined with Trametinib can effectively inhibit the growth of subcutaneous xenografts of lung cancer cells with down-regulation of CLU

[0046] (1) Resuspend the Hop62-shCLU of CLU-knockdown lung cancer cells in BD Matrigel (3×10 6 For cell counting, cells were resuspended in 100 μL BD Matrigel). Inoculate 100 μL of the above cell and matrix mixture subcutaneously into the left and right lower backs of nude mice.

[0047] (2) Six days after inoculation of nude mice and tumor fixation, the nude mice were divided into groups, and Hop62-shCLU was divided into four groups, namely blank group (no treatment), NG25 treatment group (intraperitoneal injection, 4mg / kg / Day), Tram treatment group (gastric administration, 1mg / kg / Day) and NG25 combined with Tram treatment group (two drugs administered at the same time). Hop62-shGFP was the cell control group.

[0048] (3) The tumor size was measured every two days at the beginning of treatment, according to the formula: volu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a medicine for treating lung cancer. The medicine is composed of NG25 and trametinib at a mass ratio of 4 to 1; and the lung cancer is a lung cancer in which the function of CLU genes is absent or down-regulated. Further, the lung cancer is a lung cancer in which the function of the CLU genes is absent or down-regulated and is driven by KRASG 12D oncogenes. In vitro experiments show that CLU knock-down lung cancer cells are more sensitive to NG25, compared with controls, the NG25 can significantly inhibit the growth of the lung cancer cells, and while after the cells are treated by combining with the Trametinib, it is found that the inhibition on the lung cancer cells is even more significant. Similarly, in animal models, a TAK1 inhibitor NG25 can inhibit the growthof CLU knock-down cell transplantation tumors and CLU knock-out orthotopic lung cancer, the treatment combined with the Trametinib can significantly shrink the tumor, and the purpose of treating thetype of the lung cancer is achieved.

Description

technical field [0001] The invention belongs to the field of biomedicine, in particular to a drug for treating lung cancer, in particular to a TAK1 inhibitor NG25 combined with trametinib (Trametinib) for KRAS with CLU gene function loss G12D Drugs for the treatment of oncogene-driven lung cancer. Background technique [0002] It is known that the occurrence of lung cancer is mainly related to the changes of oncogenes. KRAS is a common driver gene mutation in lung cancer, which occurs in 10-30% of lung cancer patients. So far, there is no clinically effective targeted therapy drug or method for this type of lung cancer. [0003] Although targeted therapy for lung cancer has achieved certain results, there are still a considerable number of patients who take inhibitors of oncogenes that are mutated in tumors and do not show the desired therapeutic effect. There are many reasons for this, but the role of tumor suppressor genes deserves attention. In-depth research also sho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/519A61P35/00A61P35/04A61K31/497
CPCA61K31/497A61K31/519A61P35/00A61P35/04A61K2300/00
Inventor 陈良陈智鹏
Owner JINAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com