Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A triple fluorescent quantitative PCR detection method and kit for Rhizoctonia solani of cruciferous vegetables

A technology of cruciferous vegetables and Rhizoctonia solani, applied in the field of molecular biology, can solve problems such as difficult to distinguish, time-consuming disease detection, laborious fungal compound infection, etc., and achieve simple operation, shortened detection time, and high sensitivity Effect

Active Publication Date: 2022-06-24
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved by the present invention is to provide a triple fluorescent quantitative PCR detection method and kit for the cruciferous vegetable Rhizoctonia solani, which solves the time-consuming and laborious detection of the cruciferous vegetable Rhizoctonia solani disease by traditional methods. And the practical problem that it is difficult to distinguish and identify when other fungi are co-infected

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A triple fluorescent quantitative PCR detection method and kit for Rhizoctonia solani of cruciferous vegetables
  • A triple fluorescent quantitative PCR detection method and kit for Rhizoctonia solani of cruciferous vegetables
  • A triple fluorescent quantitative PCR detection method and kit for Rhizoctonia solani of cruciferous vegetables

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1 Synthesis of primers and probes

[0059] Synthesis of primers and probes for triple fluorescence quantitative PCR detection of R. solani fusion groups AG-2-1, AG-1-IB and AG-4HGII, the specific steps are as follows:

[0060] (1) Primers and probes of R. solani fusion group AG-2-1:

[0061] AG-2-1 upstream primer: 5'-GCTACAACCCCAAGTCGG-3' (SEQ ID NO: 1)

[0062] AG-2-1 downstream primer: 5'-GTAAAAGCGTAAAACCTGGGTG-3' (SEQ ID NO: 2)

[0063] AG-2-1 probe: 5'-FAM-CCTATCTCTGGATGGCACGGTGAC-TAMRA-3' (SEQ ID NO:3);

[0064] (2) Primers and probes of R. solani fusion group AG-1-IB:

[0065] AG-1-IB upstream primer: 5'-AACAAGATGGACACTACCAAGG-3' (SEQ ID NO:4)

[0066] AG-1-IB downstream primer: 5'-GGTCCTCGCTCCACTATAAAG-3' (SEQ ID NO:5)

[0067] AG-1-IB probe: 5'-VIC-AGTACAAACTCCACTCGGGTAACGACA-TAMRA3' (SEQ ID NO: 6);

[0068] (3) Primers and probes of R. solani fusion group AG-4HGII:

[0069] (1) AG-4HGII upstream primer: GCGCGGTAAAGGAATTTTGC (SEQ ID NO: 7)

[00...

Embodiment 2 3

[0072] Example 2 Preparation of triple fluorescent quantitative PCR detection premix

[0073] The preparation of triple fluorescent quantitative PCR detection mixture, the specific steps are as follows:

[0074] The following components synthesized in Example 1 were mixed well to obtain a mixed solution for the detection of R. solani fusion groups AG-2-1, AG-1-IB and AG-4HGII by triple fluorescence quantitative PCR.

[0075] AG-2-1 upstream primer: 0.2μL / test;

[0076] AG-2-1 downstream primer: 0.2μL / test;

[0077] AG-2-1 probe: 1μL / test;

[0078] AG-1-IB upstream primer: 0.3μL / test;

[0079] AG-1-IB downstream primer: 0.3μL / test;

[0080] AG-1-IB probe: 1μL / test;

[0081] AG-4HGII upstream primer: 0.2μL / test;

[0082] AG-4HGII downstream primer: 0.2μL / test;

[0083] AG-4HGII probe: 1 μL / test;

[0084] qPCR MIX: 10.4 μL / test;

[0085] Double distilled water: 4.2 μL / test.

Embodiment 3

[0086] The preparation of embodiment 3 positive control substance

[0087] Preparation of positive controls in the triple fluorescent quantitative PCR detection kit for R. solani fusion groups AG-2-1, AG-1-IB and AG-4HGII:

[0088] (1) Construction of plasmid

[0089] 1. Construction of the R. solani fusion group AG-2-1 plasmid: PCR was used to amplify the nucleic acid of the R. solani fusion group AG-2-1 sample (preserved by the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences). , the obtained sequence is:

[0090] 5'-GCTACAACCCCAAGTCGGTCGCTTTCGTCCCTATTTCTGGATGGC ACGGTGACAACATGTTGGAGGAGTCCGTCAAGTACGTCATACTGTCGCACCCAGGTTTACGCTTTTAC-3' (SEQ ID NO: 10) nucleic acid fragment of the target amplification sequence, the primer sequences are shown in SEQ ID NO: 1-3. After purification of the amplified fragment, it was cloned into pMD19-T vector by TA, and the recombinant vector with correct sequencing result was transformed into DH5α and amplified to obt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a triple fluorescent quantitative PCR detection kit for the cruciferous vegetable Rhizoctonia solani, comprising 3 pairs of primers and probes: AG-2-1-F, AG-2-1-R, AG-2 2‑1‑P, AG‑1‑IB‑F, AG‑1‑IB‑R, AG‑1‑IB‑P, AG‑4HGII‑F, AG‑4HGII‑R, AG‑4HGII‑P. The kit also includes triple fluorescent quantitative PCR detection master mix, blank control substance, negative control substance and positive control substance. The present invention uses three dominant fusion group standard strains of Rhizoctonia solani disease as positive materials, cabbage plant tissues as negative materials, and other soil-borne pathogenic bacteria as identification materials, and uses multiple fluorescent quantitative PCR for detection, with accurate results and high sensitivity. High, good repeatability, primers and probes have extremely high specificity, and can quickly and accurately identify the cruciferous vegetable Rhizoctonia solani.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a triple fluorescence quantitative PCR detection method and a kit of a cruciferous vegetable Rhizoctonia solani dominant fusion group AG-2-1, AG-1-IB and AG-4HGII . Background technique [0002] Rhizoctonia solani belongs to the amorphous subphylum Deuterobacteria and is an important soil-borne fungus. According to mycelial fusion, pathogenicity and phylogenetic differences, Rhizoctonia solani is divided into 14 different fusion groups (Anastomosis group, AG) and at least 20 fusion subgroups. The pathogen has a wide range of hosts and can infect vegetables such as Solanaceae, Cucurbitaceae, Chenopodiaceae, and Cruciferae, as well as crops such as rice, corn, wheat, and cotton, causing standing blight, leaf rot, root rot, sheath blight, etc. symptom. Among them, the fusion groups infecting cruciferous vegetables mainly include AG-2-1, AG-1-IB and AG-4HGII, which can c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/6851C12Q1/04C12R1/645
CPCC12Q1/6895C12Q1/6851C12Q2600/16C12Q2531/113C12Q2537/143C12Q2563/107
Inventor 石延霞李宝聚王朵谢学文柴阿丽
Owner INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com