Unlock instant, AI-driven research and patent intelligence for your innovation.

Monovalent anti-properdin antibodies and antibody fragments

A technology of antibody fragments and monovalent antibodies, applied in the field of medicine for the treatment of diseases mediated by disorders of the alternative complement pathway

Pending Publication Date: 2020-02-21
ALEXION PHARMA INC
View PDF35 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There remains an unmet need for efficient modulation of properdin activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Monovalent anti-properdin antibodies and antibody fragments
  • Monovalent anti-properdin antibodies and antibody fragments
  • Monovalent anti-properdin antibodies and antibody fragments

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0282] Example 1.V HH - Generation of His fusion cloning (in-fusion cloning) vector

[0283] The pBNJ391 vector was digested with restriction enzymes BstEII and EcoRI to remove the hinge and Fc. The vector was gel purified to yield a 1000 bp release product. The annealed oligonucleotides UDEC6629 / 6630 were cloned into pBNJ391 vector using BstEII / EcoRI. Annealed oligonucleotides contain the following sequences:

[0284] UDEC 6629 forward primer:

[0285] GTCACCGTGTCGAGCCATCATCACCATCATCATCACTGATGAG (SEQ ID NO: 65)

[0286] UDEC 6630 reverse primer:

[0287] AATTCTCATCATTTGTCATCATCATCCTTATAGTCGCTCGACACG (SEQ ID NO: 66)

[0288] The final vector contains BstEII-6xHis-EcoRI sites.

[0289] Next, the pNGH0320 vector was digested with XhoI / BstEII (yielding a 13 bp release product) and column purified. Next, use V HH Phage cloning templates for PCR amplification of inserts. Forward primer UDEC 6438 (GTCCACTCCCTCGAGGTGCAGCTGGTGGAGTCTGGG; SEQ ID NO: 67) and reverse primer UDEC...

Embodiment 2

[0304] Example 2. Anti-properdin V HH Antibody binding to human properdin

[0305] figure 1 Display kinetic binding measurements can be performed on an Octet instrument (FortéBio Inc.). All washes, dilutions and measurements were performed in kinetic buffer (FortéBio cat 185032) with plates shaking at 1000 rpm. Streptavidin biosensors (Forte Bio Cat: 18-5019 lot: 1405301 ) were equilibrated in kinetic buffer for 10 minutes before loading with 50nm biotinylated human properdin. For the binding phase, add 10 μg / mL of the anti-properdin antibody of choice or kinetic buffer blank, respectively, to the biosensor preloaded with biotinylated human properdin. The results show that AB005, AB006, AB007 and AB008 bind to human properdin.

[0306] figure 2 Shows that kinetic binding measurements can be performed on an Octet instrument (Forté Bio Inc). All washes, dilutions and measurements were performed in kinetic buffer (Forté Biocat 185032) with plates shaking at 1000 rpm. Stre...

Embodiment 3

[0308] Example 3 Alternative Complement Hemolysis Assay

[0309] Figure 4 An alternative complement pathway mediated hemolysis assay based on the formation of terminal complement complexes on the surface of rabbit red blood cells (rRBC) is shown. Due to the formation of this complex, rRBCs are lysed. Agents that inhibit complement complex formation are expected to inhibit cell lysis. Various anti-properdin antigen-binding fragments were tested to assess effects on cell lysis mediated by alternative complement activation. by supplementing with 10 mM EGTA and 10 mM MgCl 2 Dilute 40% normal human serum in gelatin veronal buffer (GVB) (eg, 1600 μL normal human serum) to supplemented with 10 mM EGTA and 10 mM MgCl 2 "Assay plate" was prepared in 2400 μL of GVB). 50 μL of this solution was dispensed into each well of an assay plate (polystyrene). Next, by dissolving 50 μL / well of 2× mAb (eg, anti-properdin Fab) in supplemented with 10 mM EGTA and 0-10 mM MgCl 2 Dilution plat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Described herein are isolated monovalent antibodies or antibody fragments thereof that bind human properdin. Such antibodies are useful in methods of treatment for diseases mediated by alternative complement pathway dysregulation.

Description

Background technique [0001] The complement system plays an important role in the clearance of immune complexes and the immune response to infectious agents, foreign antigens, virus-infected cells, and tumor cells. Complement activation occurs mainly through three pathways: the classical pathway, the lectin pathway and the alternative pathway. Uncontrolled activation or inadequate regulation of alternative complement pathways can lead to systemic inflammation, cellular damage, and tissue damage. The alternative complement pathway is implicated in the pathogenesis of an increasing number of diseases. Properdin actively regulates alternative complement pathway activation by binding and stabilizing the C3 and C5 convertase complexes (C3bBb and C3bnBb). Inhibition or modulation of properdin activity is an important therapeutic strategy for reducing symptoms and slowing disease progression associated with dysregulation of the alternative complement pathway. There remains an unmet...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/395C07K16/18
CPCA61K39/395C07K16/18C07K2317/569C07K2317/92C07K2319/21A61P37/02C07K2317/76C07K2317/31C07K2317/24C07K2317/33C07K2317/22C07K2317/34C07K2317/94C07K2319/00A61K2039/505A61P7/00C07K2317/565
Inventor 道格拉斯.L.谢里登保罗.P.腾博尼塔妮莎·安-塔纳拉·麦克沃尔特·C·韦格特里
Owner ALEXION PHARMA INC