Application of Arabidopsis gif1 gene in regulation of seed size
A technology for seeds and plant seeds, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of complex seed development process and unclear molecular mechanism.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Embodiment 1, the application of Arabidopsis GIF1 gene in regulating the size of plant seeds
[0061] 1. Preparation of transgenic Arabidopsis thaliana overexpressing the GIF1 gene
[0062] 1. Amplification of GIF1 gene
[0063] The wild-type Arabidopsis Col-0 seedlings grown on 1 / 2MS medium on the 9th day were used as materials, and the total RNA in the seedlings was extracted with a plant total RNA extraction kit (TIANGEN, DP432); using the total RNA as a template, use lnRcute lncRNA cDNA First Strand Synthesis Kit (TIANGEN, KR202) was used to synthesize cDNA sequence; cDNA was used as template and GIF1-F and GIF1-R sequences were used as primers for PCR amplification to obtain 675bp PCR amplification product V6-GIF1.
[0064] GIF1-F: TCTAGAGGATCCCCGGGTACCATGCAACAGCACCTGATGCAGAT
[0065] GIF1-R: GATCGGGGAAATTCGAGCTCTCAATTCCCATCATCTGATG
[0066] After sequencing, the nucleotide sequence of the PCR product is sequence 3.
[0067] In sequence 3, the 22nd-654th is the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


