Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of Arabidopsis gif1 gene in regulation of seed size

A technology for seeds and plant seeds, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of complex seed development process and unclear molecular mechanism.

Active Publication Date: 2021-08-10
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the seed development process is complex, and the molecular mechanism that ultimately determines the size of the seed is still unclear.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Arabidopsis gif1 gene in regulation of seed size
  • Application of Arabidopsis gif1 gene in regulation of seed size
  • Application of Arabidopsis gif1 gene in regulation of seed size

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Embodiment 1, the application of Arabidopsis GIF1 gene in regulating the size of plant seeds

[0061] 1. Preparation of transgenic Arabidopsis thaliana overexpressing the GIF1 gene

[0062] 1. Amplification of GIF1 gene

[0063] The wild-type Arabidopsis Col-0 seedlings grown on 1 / 2MS medium on the 9th day were used as materials, and the total RNA in the seedlings was extracted with a plant total RNA extraction kit (TIANGEN, DP432); using the total RNA as a template, use lnRcute lncRNA cDNA First Strand Synthesis Kit (TIANGEN, KR202) was used to synthesize cDNA sequence; cDNA was used as template and GIF1-F and GIF1-R sequences were used as primers for PCR amplification to obtain 675bp PCR amplification product V6-GIF1.

[0064] GIF1-F: TCTAGAGGATCCCCGGGTACCATGCAACAGCACCTGATGCAGAT

[0065] GIF1-R: GATCGGGGAAATTCGAGCTCTCAATTCCCATCATCTGATG

[0066] After sequencing, the nucleotide sequence of the PCR product is sequence 3.

[0067] In sequence 3, the 22nd-654th is the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of Arabidopsis thaliana GIF1 gene in regulating seed size. The present invention provides the application of any one of the following 1)-3) in regulating the size of plant seeds; 1) protein GIF1; 2) nucleic acid molecules encoding protein GIF1; 3) recombinant vectors containing nucleic acid molecules encoding protein GIF1 , expression cassette or recombinant bacteria; experiments of the present invention have proved that the Arabidopsis GIF1 gene has an important regulatory effect on seed size, the GIF1 gene function loss mutant gif1 produces small seeds, and the overexpression GIF1 gene plant (35S: Myc-GIF1) Large seeds can be produced, the gene can be used to increase plant seed production, and has important implications for plant breeding.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of Arabidopsis thaliana GIF1 gene in regulating seed size. Background technique [0002] The staple food of human beings mainly comes from the seeds of crops, such as rice and wheat. There are three factors that determine the yield of rice and wheat: panicle number, grain weight and tiller number. Seed weight is closely related to seed size, so seed size is an important agronomic trait and an important factor in determining the seed yield of plants. With today's rapid population growth, decreasing per capita arable land and the impact of global climate change on the environment, human food is facing a shortage. How to increase human food has become a major problem that needs to be solved urgently. Therefore, excavating genes that affect plant seed size and developing High-yielding genetic resources and increasing grain production are of great value to ens...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82A01H5/10A01H6/20C07K14/415C12N15/29
CPCC07K14/415C12N15/8261
Inventor 刘祖培李云海李娜
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI