A gene encoding protein factor rrf and its application in the production of n-acetylglucosamine

An acetamido, encoding gene technology, applied in the field of metabolic engineering, can solve problems such as undisclosed overexpression, and achieve the effects of increasing accumulation, good application prospects, and easy use

Active Publication Date: 2022-01-18
JIANGNAN UNIV +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, none of the above documents disclosed that overexpression of RRF can increase the production of N-acetylglucosamine in Corynebacterium glutamicum

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gene encoding protein factor rrf and its application in the production of n-acetylglucosamine
  • A gene encoding protein factor rrf and its application in the production of n-acetylglucosamine
  • A gene encoding protein factor rrf and its application in the production of n-acetylglucosamine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Knockout of the L-lactate dehydrogenase encoding gene (ldh)

[0054] According to the upstream and downstream sequences of the Corynebacterium glutamicum ATCC 13032 L-lactate dehydrogenase coding gene (ldh) (nucleotide sequence shown in SEQ ID NO.1) published on NCBI, design knockout homology arms Amplification primers, left arm upper and lower primers are respectively LdhloxPUF (nucleotide sequence shown in SEQ ID NO.2) and LdhloxPUR (nucleotide sequence shown in SEQ ID NO.3); right arm upper and lower primers Respectively LdhloxPDF (nucleotide sequence as shown in SEQ ID NO.4) and LdhloxPDR (nucleotide sequence as shown in SEQ ID NO.5); Respectively with Corynebacterium glutamicum S9114 strain genomic DNA as template, by PCR Extend the left and right arms.

[0055] Primers KanloxpldhF (nucleotide sequence shown in SEQ ID NO.6) and KanloxpldhR (nucleotide sequence shown in SEQ ID NO.6) and KanloxpldhR (nucleotide sequence shown in Shown in SEQ ID NO.7), the...

Embodiment 2

[0057] Example 2 Construction of recombinant plasmid pJYW-4-ceN-C.glglmS-RRF and construction of recombinant Corynebacterium glutamicum

[0058] (1) Design amplification primers to amplify RRF according to the S9114 genome

[0059] Upstream primer FragmentRRF.FOR:

[0060] 5' - ACCGTCGAATAATATAAACAGCGTGGCTTATCTAGGTTCG - 3';

[0061] Downstream primer FragmentRRF.REV:

[0062] 5' - CCTTTGCTAGTCTAGACCTCCTCATCAGTTCCTTTTTCCT - 3';

[0063] Simultaneously design vector pJYW-4-ceN-C.glglmS linearization primer

[0064] Upstream primer VectorRRF.FOR:

[0065] 5' - TGGAGGTCTAGACTAGCAAAGGAGAAGAAAAGCCG - 3';

[0066] Downstream primer VectorRRF.REV:

[0067] 5' - ACGCTGTTTATATTATTCGACGGTGACAGACTTTGC - 3';

[0068] Use primers FragmentRRF.FOR ​​and FragmentRRF.REV, Corynebacterium glutamicum S9114 as a template, PCR conditions: 95°C for 10 min; 98°C for 1 min; 55°C for 1 min; 72°C for 1 min, 30 cycles of reaction; Finally, 72°C was extended for 10 min, and the PCR product was rec...

Embodiment 3

[0088] Effect of overexpressing frr gene on N-acetylglucosamine production in recombinant Corynebacterium glutamicum in embodiment 3

[0089] Inoculate the recombinant Corynebacterium glutamicum strain containing the plasmid pJYW-4-ceN-C.glglmS-RRF with the correct sequencing results on a streaked LBG plate (adding thiokanamycin 25 mg / L) in a glycerol tube, and inoculate at 30°C After culturing at 220rpm for 18 hours, select a single colony and re-stretch the LBG plate until a large number of colonies grow.

[0090] Inoculate a loop of single colonies into the seed medium, and culture at 220 rpm at 30°C for 16 to 18 hours until the cell growth logarithmic phase.

[0091] The seed culture solution was inoculated into the fermentation medium according to the inoculum amount of 10%, and cultivated at 30° C. and 220 rpm for 72 hours. GlcNAc production was measured.

[0092] Taking the recombinant bacterium containing plasmid pJYW-4-ceN-C.glglmS as a control, it was cultured and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant Corynebacterium glutamicum for producing N-acetylglucosamine and an application thereof, belonging to the field of metabolic engineering. The recombinant Corynebacterium glutamicum is obtained by overexpressing the ribosome recycling factor RRF from the Corynebacterium glutamicum. The recombinant Corynebacterium glutamicum of the invention improves the yield of acetylglucosamine, and the yield reaches 26.9g / L, which lays a foundation for further metabolic engineering transformation of the Corynebacterium glutamicum to produce glucosamine.

Description

technical field [0001] The invention relates to the field of metabolic engineering, in particular to a protein factor RRF coding gene and its application in the production of N-acetylglucosamine. Background technique [0002] N-acetylglucosamine (GlcNAc) is a derivative of glucosamine, which has reducing properties and is also an important precursor for the synthesis of bifidofactor and hyaluronic acid, also known as 2-(acetylamino)-2-deoxy-glucose And N-acetylglucosamine, which is the basic unit of various polysaccharides in organisms, has important physiological functions in organisms. Corynebacterium glutamicum, a high GC-content Gram-positive soil bacterium in the Actinobacteria phylum, has been used in the industrial production of amino acids and has been engineered to produce a variety of compounds, including polymer building blocks and biofuels. Since its genome sequence was first published, its multifunctional metabolic pathways and their genetic components and regu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/31C12P19/26C12R1/15
CPCC07K14/34C12N9/18C12N9/0006C12N9/78C12P19/26C12Y301/01033C12Y101/01027C12Y305/99006
Inventor刘龙邓琛卢健行刘长峰卢建功李江华堵国成陈坚
OwnerJIANGNAN UNIV