Passiflora internal reference gene and its screening method and application
An internal reference gene, the technology of passionflower, applied in the field of molecular biology, can solve the problems that restrict the research process of passionflower cloning, etc., and achieve the effect of shortening the detection time, optimizing the PCR amplification program, and improving the detection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Passiflora internal reference gene, the internal reference gene is C21209, the nucleotide sequence of the internal reference gene C21209 is shown in SEQ ID NO.1.
Embodiment 2
[0032] A primer for PCR amplification of an internal reference gene C21209, the nucleotide sequence is as shown in SEQ ID NO.2 for the forward sequence and SEQ ID NO.3 for the reverse sequence. Forward sequence: AGCTCTTTCTACATCTGCGCT, reverse sequence: TTCTTGTGCATCTTCCCCCG.
Embodiment 3
[0034] A screening method for Passiflora internal reference gene C21209, comprising the following steps:
[0035] S1. Download 4 sample data from the NCBI database, the sequence accession numbers are: SRX4224487, SRX4224486, SRX4224485 and SRX4224484;
[0036] Use Trinity (version r20131110) software, parameter min_kmer_cov 2 for sequence assembly; use RSEM (v1.2.3) for expression analysis of predicted sequences;
[0037] Functional annotation of gene sequences using BLAST (v2.2.31) and databases NR, COG, KOG, eggNOG, KEGG, GO, Pfam and Swiss-prot;
[0038] The stability of the expression values of all Passiflora genes in the 4 samples was calculated, and the coefficient of variation (CV) was used to evaluate, and the genes with a CV value less than 0.2 and cDNA ≥ 1000bp were selected as candidate memory genes.
[0039] S2. From among the candidate genes, according to the expression value of the Passiflora gene, five genes with high expression levels (FPKM≈850) were selecte...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com