Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Passiflora internal reference gene and its screening method and application

An internal reference gene, the technology of passionflower, applied in the field of molecular biology, can solve the problems that restrict the research process of passionflower cloning, etc., and achieve the effect of shortening the detection time, optimizing the PCR amplification program, and improving the detection efficiency

Active Publication Date: 2020-09-01
GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This seriously restricts the research process of important trait gene mapping and cloning of Passiflora

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Passiflora internal reference gene and its screening method and application
  • Passiflora internal reference gene and its screening method and application
  • Passiflora internal reference gene and its screening method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Passiflora internal reference gene, the internal reference gene is C21209, the nucleotide sequence of the internal reference gene C21209 is shown in SEQ ID NO.1.

Embodiment 2

[0032] A primer for PCR amplification of an internal reference gene C21209, the nucleotide sequence is as shown in SEQ ID NO.2 for the forward sequence and SEQ ID NO.3 for the reverse sequence. Forward sequence: AGCTCTTTCTACATCTGCGCT, reverse sequence: TTCTTGTGCATCTTCCCCCG.

Embodiment 3

[0034] A screening method for Passiflora internal reference gene C21209, comprising the following steps:

[0035] S1. Download 4 sample data from the NCBI database, the sequence accession numbers are: SRX4224487, SRX4224486, SRX4224485 and SRX4224484;

[0036] Use Trinity (version r20131110) software, parameter min_kmer_cov 2 for sequence assembly; use RSEM (v1.2.3) for expression analysis of predicted sequences;

[0037] Functional annotation of gene sequences using BLAST (v2.2.31) and databases NR, COG, KOG, eggNOG, KEGG, GO, Pfam and Swiss-prot;

[0038] The stability of the expression values ​​of all Passiflora genes in the 4 samples was calculated, and the coefficient of variation (CV) was used to evaluate, and the genes with a CV value less than 0.2 and cDNA ≥ 1000bp were selected as candidate memory genes.

[0039] S2. From among the candidate genes, according to the expression value of the Passiflora gene, five genes with high expression levels (FPKM≈850) were selecte...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a passion flower reference gene as well as a screening method and an application thereof, which belong to the field of molecular biology. The RNA-Seq sequencing data is used foranalyzing genes with high and stable expression quantity to serve as candidate reference genes, five genes with high expression quantity (FPKM is approximately equal to 850) are selected, primer designing is carried out, verification is carried out in mRNA of different tissue parts of a passion flower variety with obvious phenotypic difference, the expression stability of each candidate referencegene is evaluated by utilizing software, and finally a proper passion flower reference gene C21209 is screened out. The C21209 can be stably expressed in stems, leaves, flowers and fruits of TainungNo.1 and golden fruit No.2, and reference is provided for subsequent scientific research related to passion flower gene expression.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to an internal reference gene of passionflower and its screening method and application. Background technique [0002] Passiflora is an important fruit tree in southern my country. Its fruit has an aromatic smell, is rich in carbohydrates, vitamins and mineral elements, and has high nutritional value and good economic benefits. Passion fruit juice contains 165 kinds of fruit aromas such as pineapple, banana, strawberry, apple, sour plum, mango, etc. . Its natural raw juice is known as the natural nutrient concentrate and queen of tropical fruits for its bright color, unique and strong aromatic flavor, rich nutrition and health care effect on the human body. Passiflora fruit not only has high nutritional value, promotes body fluids and quenches thirst, but also has the effect of disease prevention and fitness. According to the determination, passion fruit juice contains more than ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/6851C12N15/29
CPCC12Q1/6851C12Q1/6895C12Q2600/158C12Q2531/113C12Q2545/101C12Q2563/107
Inventor 吴艳艳黄伟华刘洁云田青兰杨行海牟海飞
Owner GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com