PCR primer group for detecting pepper mild mottle virus, test kit and application thereof
A mottle virus and pepper light technology, applied in the field of PCR primer sets for detection of pepper light mottle virus, can solve the problems of inability to exclude false negatives and inaccurate test results, avoiding false positive results, avoiding false positives, and strong stability. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] A partial sequence-specific primer for MP and CP genes (4952-5942 bp region) of capsicum mild mottle virus (PMMoV) genome and two specific primers for Actin, an internal reference gene of capsicum, among which, three capsicum mild mottle virus (PMMoV) genome MP and CP The gene partial sequence specific primers are PMMoV-F1, PMMoV-F470 and PMMoV-R991 respectively, and the two capsicum internal reference gene Actin specific primers are PeActin-F1 and PeActin-R1093, as follows:
[0033] PMMoV-F1: TCCGAGAAGTGCCGACA, as shown in SEQ ID NO.1;
[0034] PMMoV-F470:GTTCAACGGGTCCTCCTTC, as shown in SEQ ID NO.2;
[0035] PMMoV-R991: TCAATTTGTCTGCCGCTGAG, as shown in SEQ ID NO.3;
[0036] PeActin-F1:GTGACAATGGAACAGGAATG, as shown in SEQ ID NO.4;
[0037]PeActin-R1093:CACTTCCGGTGGACAATG, as shown in SEQ ID NO.5.
[0038] The PCR detection method that adopts primer set as above to detect capsicum mild mottle virus (PMMoV) comprises the following steps:
[0039] (1) Take the sampl...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com