Unlock instant, AI-driven research and patent intelligence for your innovation.

PCR primer group for detecting pepper mild mottle virus, test kit and application thereof

A mottle virus and pepper light technology, applied in the field of PCR primer sets for detection of pepper light mottle virus, can solve the problems of inability to exclude false negatives and inaccurate test results, avoiding false positive results, avoiding false positives, and strong stability. Effect

Pending Publication Date: 2020-04-24
GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current RT-PCR methods only use a pair of specific primers to detect PMMoV, so that false negatives cannot be ruled out, and false positives may even occur, resulting in inaccurate detection results.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR primer group for detecting pepper mild mottle virus, test kit and application thereof
  • PCR primer group for detecting pepper mild mottle virus, test kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] A partial sequence-specific primer for MP and CP genes (4952-5942 bp region) of capsicum mild mottle virus (PMMoV) genome and two specific primers for Actin, an internal reference gene of capsicum, among which, three capsicum mild mottle virus (PMMoV) genome MP and CP The gene partial sequence specific primers are PMMoV-F1, PMMoV-F470 and PMMoV-R991 respectively, and the two capsicum internal reference gene Actin specific primers are PeActin-F1 and PeActin-R1093, as follows:

[0033] PMMoV-F1: TCCGAGAAGTGCCGACA, as shown in SEQ ID NO.1;

[0034] PMMoV-F470:GTTCAACGGGTCCTCCTTC, as shown in SEQ ID NO.2;

[0035] PMMoV-R991: TCAATTTGTCTGCCGCTGAG, as shown in SEQ ID NO.3;

[0036] PeActin-F1:GTGACAATGGAACAGGAATG, as shown in SEQ ID NO.4;

[0037]PeActin-R1093:CACTTCCGGTGGACAATG, as shown in SEQ ID NO.5.

[0038] The PCR detection method that adopts primer set as above to detect capsicum mild mottle virus (PMMoV) comprises the following steps:

[0039] (1) Take the sampl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a PCR (Polymerase Chain Reaction) primer group for detecting pepper mild mottle virus, the PCR primer group comprises three pepper mild mottle virus (PMMoV) genome motor protein (MP) and coat protein (CP) coding gene partial sequence specific primers and two pepper reference gene Actin specific primers, wherein the three pepper mild mottle virus (PMMoV) genome motor protein(MP) and coat protein (CP) coding gene partial sequence specific primers are PMMoV-F1, PMMoV-F470 and PMMoV-R991 respectively, and the partial sequence specific primers of the MP gene and the CP geneare PMMoV-F470 and PMMoV-R991; the two pepper reference gene Actin specific primers are PeActin-F1 and PeActin-R1093. The PCR amplification result is detected in 1.0%-1.5% agarose, an expensive fluorescent quantitative PCR instrument is not needed, and the PCR primer group has the advantages of being rapid, economical, high in stability, high in accuracy and high in sensitivity.

Description

technical field [0001] The invention belongs to the technical field of crop virus detection, and in particular relates to a PCR primer set, a kit and an application thereof for detecting pepper mild mottle virus (PMMoV). Background technique [0002] Pepper mild mottle virus (PMMoV) is a (+) sRNA virus of the genus Tobamovirus, which was first discovered in the United States and later reported in Germany, the Netherlands, the United Kingdom, Canada, Australia and other countries . The virus is mainly transmitted through seeds and sap, and the vector is not easy to transmit the virus. The infected seeds, infected plants and infected soil are important sources of infection, and can survive for 25 years on dry plant residues. PMMoV infection of pepper plants can cause leaf shrinkage, mottled and mosaic symptoms, fruit chlorosis and mottled, smaller, deformed and even local necrosis and shedding, causing serious harm to pepper production. In 1994, the harm of the virus was fir...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11C12R1/94
CPCC12Q1/701C12Q1/686
Inventor 龚明霞王日升赵虎王萌赵曾菁吴星黄金梅何志
Owner GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI