Method for quantitatively detecting human T-cell lymphotropic virus provirus

A technology for quantitative detection of lymphocytes, applied in the field of medical testing, can solve the problems of time-consuming, laborious, and inability to accurately quantify the number of virus copies, and achieve high sensitivity, high repeatability, high sensitivity and specificity

Pending Publication Date: 2020-06-09
BEIJING HOSPITAL
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved by the present invention is: in order to solve the problem that the existing method for detecting HTLV-1 cannot accurately quantify the virus copy number, and is time-consuming and...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quantitatively detecting human T-cell lymphotropic virus provirus
  • Method for quantitatively detecting human T-cell lymphotropic virus provirus
  • Method for quantitatively detecting human T-cell lymphotropic virus provirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1: Establishment of plasmid standards

[0058] 1. Materials

[0059] 1. Restriction endonuclease and buffer: American NEB company

[0060] 2. Hut102 cells: purchased from Peking Union Medical College

[0061] 3. NanoDrop 2000 micro-volume ultraviolet spectrophotometer: American Thermo Company

[0062] 4. Plasmid extraction kit: Axygen, USA

[0063] 5. T4 ligase and buffer: American NEB company

[0064] 6. Ordinary DNA gel recovery kit: Tiangen Biochemical (Beijing) Technology Co., Ltd.

[0065] 7. pcDNA3.1(-) plasmid: purchased from Invitrogen

[0066] 8. Competent cells of Escherichia coli DH5α: Beijing Qingke Biotechnology Co., Ltd.

[0067] 9. PCR amplification buffer (gold medal mix): Beijing Qingke Biotechnology Co., Ltd.

[0068] 2. Method

[0069] 1. Amplify the HTLV Pol gene sequence

[0070] HTLV Pol upstream and downstream primers (5' cagtagactagtccaaaccctgcccctccta (SEQ ID NO.7) and 5' tggcgagaaacttacccatggtgttggtg (SEQ ID NO.8)) were applied...

Embodiment 2

[0130] Embodiment 2: Quantitative detection of HTLV-1 positive cell Hut102 cell copy number

[0131] 1. Materials

[0132] 1. Magnetic Bead Method Blood Genomic DNA Extraction Kit (Model: DP341): Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0133] 2. Hut102 cells: purchased from Peking Union Medical College

[0134] 3. ABI7500 real-time quantitative fluorescent PCR instrument: Applied Biosystems, USA

[0135] 4.qPCR 5×Hyperstart Pre-mix: Zhuhai Baorui Biological Co., Ltd.

[0136] 2. Method

[0137] 1. Extraction of Genomic DNA

[0138] The blood genomic DNA extraction kit (model: DP341) produced by Beijing Tiangen Company was used to extract, and the gDNA of Hut102 cells (purchased by Peking Union Medical College) was extracted according to the instructions.

[0139] 2. Establish a standard curve

[0140] Choose 5×10 8 copies / μL~5×10 1 Copies / μL gradient plasmid standard to establish a standard curve: each concentration of the plasmid standard is set up 3 para...

Embodiment 3

[0150] Example 3: Quantitative detection of HTLV-1 positive proviral load in 3 cases confirmed by INNO-LIA and WB

[0151] 1. Materials

[0152] 1. Magnetic Bead Method Blood Genomic DNA Extraction Kit (Model: DP341): Tiangen Biochemical Technology (Beijing) has

[0153] limited company

[0154] 2. Hut102 cells: purchased from Peking Union Medical College

[0155] 3. ABI7500 real-time quantitative fluorescent PCR instrument: Applied Biosystems, USA

[0156] 4.qPCR 5×Hyperstart Pre-mix: Zhuhai Baorui Biological Co., Ltd.

[0157] 2. Method

[0158] 1. Extraction of sample genomic DNA

[0159] The blood genomic DNA extraction kit produced by Beijing Tiangen Company was used for extraction, and the gDNA in the sample to be tested was extracted according to the instructions.

[0160] 2. Make a standard curve

[0161] Choose 5×10 6 copies / μL~5×10 2 Copies / μL gradient plasmid standards were used to establish a standard curve: 3 parallel reactions were set up for each concen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for quantitatively detecting human T-cell lymphotropic virus provirus, and belongs to the technical field of medical examination. A plasmid for quantitatively detecting the human T-cell lymphotropic virus provirus uses escherichia coli as a vector, and the preservation number of a cloned strain transformed with the plasmid is CGMCC No.19437. The method has the following advantages: the reliable HTLV-1 fluorescence quantitative qPCR method is established, the method is simple to operate, lower in cost, good in specificity, and high in repeatability, the precision, accuracy and linear range can meet clinical testing needs, the sensitivity is high, the minimum detection limit for HTLV-1 is 3 copies/[mu]L, and the method can relatively quantify the pre-viral load of HTLV-1 infected persons, and provide reliable experimental data for prognosis of the infected persons.

Description

technical field [0001] The invention relates to a method for quantitatively detecting human T lymphotropic virus provirus, in particular to a plasmid and a detection method for detecting HTLV-1 provirus by TaqMan real-time fluorescent quantitative PCR technology, and belongs to the technical field of medical testing. Background technique [0002] The detection of HTLV can be divided into two categories: screening test and confirmatory test. Enzyme-linked immunosorbent assay (ELISA) and gelatin particle agglutination assay (PA) are currently the two most widely used screening methods. PA usually uses viral lysates from cultured human T cell lines as antigens, while ELISA uses recombinant or synthetic peptides as antigens to detect antibodies in serum. These two methods have high sensitivity and low detection cost, and are suitable for large-scale blood donor screening. However, due to insufficient specificity, all samples with positive initial screening reactions need to be...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12N15/70
CPCC12Q1/702C12Q1/6851C12N15/70C12Q2600/166C12Q2531/113C12Q2545/114C12Q2563/107
Inventor 王露楠姬慧敏常乐闫颖姜心怡孙慧珍郭飞
Owner BEIJING HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap