Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting congenital aniridia pathogenic gene mutation and application of kit

A technology for detecting kits and disease-causing genes, which is applied in the field of preparation of genetic diagnostic products to achieve the effects of simple operation, low cost and direct results

Pending Publication Date: 2020-06-23
HARBIN MEDICAL UNIVERSITY
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no effective artificial iris replacement therapy in clinical practice in China, and the current treatment mainly focuses on the prevention and treatment of complications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting congenital aniridia pathogenic gene mutation and application of kit
  • Kit for detecting congenital aniridia pathogenic gene mutation and application of kit
  • Kit for detecting congenital aniridia pathogenic gene mutation and application of kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] The preparation of embodiment 1 congenital aniridia pathogenic gene mutation detection kit

[0020] 1. Design and synthesis of primer pairs

[0021] Primer 1: ATAGCAGGGAACTGACCGCC (shown in SEQ ID NO: 1)

[0022] Primer 2: TGTAACTGACCCAGGTTGAAAGAGA (shown in SEQ ID NO: 2)

[0023] It was synthesized by an automatic DNA synthesizer and diluted to 10 pmol / L.

[0024] 2. Assembling the kit

[0025] Including: 10×PCR reaction buffer, 25mM dNTP, DNA polymerase, PCR amplification primer pair and ddH 2 O.

Embodiment 2

[0026] Example 2 Application of Congenital Aniridia Pathogenic Gene Mutation Detection Kit

[0027] Use the kit obtained in Example 1 to amplify the PAX6 gene on the genomic DNA of the subject to be tested. After PCR, the product is subjected to Sanger sequencing analysis and the sequencing results are read.

[0028] 1. The specific steps are as follows:

[0029] (1) Extract the genomic DNA of the subject to be tested and dilute it to 100-200ng / ul.

[0030] (2) Synthetic primers:

[0031] Primer 1: ATAGCAGGGAACTGACCGCC (shown in SEQ ID NO: 1)

[0032] Primer 2: TGTAACTGACCCAGGTTGAAAGAGA (shown in SEQ ID NO: 2)

[0033] (3) In vitro amplification (PCR) of sample DNA target fragment

[0034] The PCR reaction system is 50ul, and the specific components are as shown in Table 1 below:

[0035] Table 1 PCR reaction system

[0036]

[0037]

[0038] After the above-mentioned mixed liquid was mixed, the target fragment was amplified on the PCR instrument, and the specific ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting congenital aniridia pathogenic gene mutation and application of the kit. Detected pathogenic gene mutation is mutation of 140th-position adenine nucleotideof a second exon of a PAX6 gene into cytidylate, namely, NM_000280.3: c.140 A>C. The kit for detecting the congenital aniridia pathogenic gene mutation comprises a 10 * PCR buffer solution, 25 mM dNTPs, DNA polymerase, a PCR amplification primer pair and ddH2O, wherein the PCR amplification primer pair consists of a primer 1 (as shown in SEQ ID NO: 1) and a primer 2 (as shown in SEQ ID NO: 2). Thekit provides a novel congenital aniridia detection means, can provide genetic diagnosis and genetic counseling for clinically conformed congenital aniridia patients, and can provide genetic diagnosisfor eye abnormal patients with undetermined phenotypes to guide clinic treatment.

Description

technical field [0001] The invention relates to a gene point mutation detection kit and application thereof, in particular to a congenital aniridia-related PAX6 gene point mutation detection kit and application thereof. The invention belongs to the technical field of gene diagnosis product preparation. Background technique [0002] Congenital aniridia is an ocular developmental disease that seriously affects the quality of life of patients. It is mainly manifested as congenital iris hypoplasia, partial or complete loss of iris tissue, and may also be accompanied by abnormal development of chamber angle, lens, cornea, macula and macula. Optic nerve hypoplasia. Some patients may experience vision loss, photophobia, and nystagmus in childhood. The ocular lesions of patients with this disease often aggravate with age, and the impact on visual function is also becoming more and more serious. Patients with other ocular lesions may develop glaucoma, cataract, corneal opacity or e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883
CPCC12Q1/6883C12Q2600/156
Inventor 原慧萍王琦邵正波刘鑫娜孙禹
Owner HARBIN MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com