Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of INPP5B gene in detection of breast cancer

A breast cancer and gene technology, applied in measurement devices, microbial determination/inspection, instruments, etc., can solve the problems of lack of specific molecular markers, difficulty in diagnosing invasive breast cancer, etc., and achieve the effect of inhibiting cell growth

Active Publication Date: 2020-08-11
YANGZHOU UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still great difficulties in the pathological diagnosis of breast cancer, especially the diagnosis of early invasive breast cancer. It is mainly judged by cell morphology and lacks effective and specific molecular markers.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of INPP5B gene in detection of breast cancer
  • Application of INPP5B gene in detection of breast cancer
  • Application of INPP5B gene in detection of breast cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Expression of INPP5B in breast cancer tissue and normal breast tissue detected by immunohistochemical technique

[0066] 1. Sample collection: 38 cases of breast cancer tissue and normal breast tissue samples were collected. All the above-mentioned specimens were obtained with the consent of the organizational ethics committee.

[0067] 2. HE staining and immunohistochemical staining for each sample

[0068] The methods of HE staining and immunohistochemical staining can be carried out according to conventional techniques in the art, and the following steps can be adopted:

[0069] HE staining

[0070] 1) Dewaxing and hydration: xylene I: 10min → xylene II: 5min → absolute ethanol I: 5min → absolute ethanol II: 5min → 95% ethanol: 1min → 90% ethanol: 1min → 70% ethanol: 1min

[0071] 2) Hematoxylin staining: 5min, fully rinse with tap water

[0072] 3) Eosin staining: 3-10s, fully rinse with tap water

[0073] 4) Warm water turns blue (the nucleus can be clearly s...

Embodiment 2

[0104] INPP5B RT-PCR quantitative detection

[0105] INPP5B gene Sybergreen RT-PCR quantitative detection primer sequence:

[0106] Forward primer: 5′-CAGAGCCGCCTCCTGGGACT-3′

[0107] Reverse primer: 5'-TGGCCATCCTCCGGTGCGTA-3'

[0108] ACTB gene Sybergreen RT-PCR quantitative detection primer sequence:

[0109] Forward primer: 5′-CACCATTGGCAATGAGCGGTTC-3′

[0110] Reverse primer: 5'-AGGTCTTTGCGGATGTCCACGT-3'

[0111] The relative expression level of INPP5B=INPP5B expression level / ACTB expression level

[0112] Real-time quantitative PCR reaction using Premix Ex TaqTM (Perfect Real Time) kit

[0113](TaKaRa Biotechnology Co., Ltd. Dalian, China) reaction system, using ThermalCycler DiceTMReal Time System (TP800 real-time fluorescent quantitative PCR instrument, TaKaRa) for operation.

[0114] see attached results figure 1 A-B.

Embodiment 3

[0116] INPP5B promoter methylation Methylight-qPCR detection:

[0117] Tissue or cell genomic DNA disulfide experiments refer to Qiagen disulfide kits.

[0118] INPP5B (forward primer-5'GTTTTGGAAGTATGAGGGTGACG-3', probe 6FAM 5'TCTTTCTTAGGCGTGCGTGACGAGGGTAGGCGGGT,

[0119] Reverse Primer - 5'TTCCCGCCGCTATAAATCG-3')

[0120] ACTB (forward primer-5′TGGTGATGGAGGAGGTTTAGTAAGT-3′, probe 6FAM5′ACCACCACCCAACACACAATAACAAACACA-3′TAMRA, reverse primer-5′AACCAATAAAACCTACTCCCTCCCTAA-3′).

[0121] The qPCR reaction refers to the Qiagen kit.

[0122] Calculate Methylation ratio = INPP5B Methylation PCR value / ACTB Methylation PCR value × 1000

[0123] see attached results figure 2 b.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene diagnosis and treatment, and discloses an INPP5B gene and application of an expression product of the INPP5B gene in diagnosis and treatment of breast cancer. The INPP5B gene is used for preparing products for diagnosing and treating the breast cancer. The INPP5B gene and the protein expression product thereof gene can be used as specific markers for diagnosing the breast cancer. The INPP5B gene and the expression product thereof can also be used as a gene treatment tool for preparing the product for treating the breast cancer, thereby providing a new breast cancer treatment approach.

Description

technical field [0001] The invention belongs to the technical field of gene diagnosis and treatment, in particular to the application of INPP5B gene in breast cancer detection. Background technique [0002] The analysis of the prevalence of malignant tumors in China in 2015 shows that breast cancer is the malignant tumor with the highest incidence rate among women in my country, and its mortality rate ranks fifth among female malignant tumors. With the development of modern medicine, the diagnosis and treatment of breast cancer has been greatly improved. However, there are still great difficulties in the pathological diagnosis of breast cancer, especially the diagnosis of early invasive breast cancer, which is mainly judged by cell morphology and lacks effective and specific molecular markers. Some patients have metastases when the cancer lesion is diagnosed, and the prognosis is poor. Therefore, it is of great significance to find new and effective tumor markers. Conten...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886G01N33/574
CPCC12Q1/6886G01N33/57415G01N33/57496C12Q2600/158
Inventor 钟晓力刘洪涛孙东瑞顾晓
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com