Application of FL2-siRNA in preparation of drug for treating corneal alkali burn and corneal alkali burn drug
A technology for alkali burn and corneal injury, which is applied in the field of medicines for treating corneal alkaline burn, and achieves the effect of being helpful for damage repair, wide application and wide application.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0019] The application of FL2-siRNA of the present invention in the preparation of medicines for the treatment of corneal alkali burns refers to the use of FL2-siRNA in the acute phase or early treatment of corneal injury diseases after corneal alkali burns, to accelerate the healing of corneal injuries, and to reduce the occurrence of post-injury complications . The specific application is that FL2-siRNA is prepared into an injection solution for subconjunctival injection of corneal alkali burns, and is used to promote local epithelial cell migration and injury healing.
[0020] The medicament for treating corneal alkali burn of the present invention is an injection containing FL2-siRNA, including cholesterol, siRNA modified by methylation, and RNase free water. The base sequence of the siRNA of the FL2 gene in the injection containing FL2-siRNA is: 5'GGTCTTGGATTCTCCCTACGA 3'.
[0021] Fidgetin is a microtubule-dependent cutting protein that can promote mitotic chromosome se...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



