Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of FL2-siRNA in preparation of drug for treating corneal alkali burn and corneal alkali burn drug

A technology for alkali burn and corneal injury, which is applied in the field of medicines for treating corneal alkaline burn, and achieves the effect of being helpful for damage repair, wide application and wide application.

Inactive Publication Date: 2020-08-28
ZHONGSHAN OPHTHALMIC CENT SUN YAT SEN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is currently no effective treatment other than keratoplasty, but these patients remain very challenging due to severe corneal neovascularization and postoperative rejection of keratoplasty

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of FL2-siRNA in preparation of drug for treating corneal alkali burn and corneal alkali burn drug
  • Application of FL2-siRNA in preparation of drug for treating corneal alkali burn and corneal alkali burn drug
  • Application of FL2-siRNA in preparation of drug for treating corneal alkali burn and corneal alkali burn drug

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0019] The application of FL2-siRNA of the present invention in the preparation of medicines for the treatment of corneal alkali burns refers to the use of FL2-siRNA in the acute phase or early treatment of corneal injury diseases after corneal alkali burns, to accelerate the healing of corneal injuries, and to reduce the occurrence of post-injury complications . The specific application is that FL2-siRNA is prepared into an injection solution for subconjunctival injection of corneal alkali burns, and is used to promote local epithelial cell migration and injury healing.

[0020] The medicament for treating corneal alkali burn of the present invention is an injection containing FL2-siRNA, including cholesterol, siRNA modified by methylation, and RNase free water. The base sequence of the siRNA of the FL2 gene in the injection containing FL2-siRNA is: 5'GGTCTTGGATTCTCCCTACGA 3'.

[0021] Fidgetin is a microtubule-dependent cutting protein that can promote mitotic chromosome se...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of FL2-siRNA in preparation of a drug for treating corneal alkali burn. The FL2-siRNA is used for acute or early treatment of a corneal injury disease after corneal alkali burn, so that corneal injury healing is accelerated and the occurrence of complications after injury is reduced; and the FL2-siRNA is prepared into an injection for subconjunctival injection of corneal alkali burn and is used for promoting migration of local epithelial cells and injury healing. The drug for treating corneal alkali burn is characterized by being an injection containing FL2-siRNA, and comprising cholesterol, methylated siRNA and RNase free water. An accurate treatment target is provided for corneal alkali burn; and a theoretical basis is provided for drug treatment ofchemical corneal alkali burn.

Description

technical field [0001] The invention relates to the technical field of medicines for treating alkali burns of the cornea, in particular to the application of FL2-siRNA in the preparation of medicines for treating alkali burns of the cornea and the medicines for alkali burns of the cornea. Background technique [0002] Vision provides humans with more than 85% of all information about the external world. Ocular chemical injury, especially corneal alkaline burn, is a common refractory blinding eye disease in my country, and it is one of the most difficult common causes of treatment. In terms of treatment and prognosis, it is more devastating than acid burn or mechanical corneal injury. It causes extensive corneal neovascularization, corneal ulceration, and corneal scarring, leading to corneal perforation and vision loss or even blindness, with a persistent and devastating impact on quality of life. There is currently no effective treatment other than keratoplasty, but these ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/7105A61P27/02
CPCA61K9/0019A61K31/7105A61P27/02
Inventor 周世有彭文艳
Owner ZHONGSHAN OPHTHALMIC CENT SUN YAT SEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More