Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

siRNA for inhibiting expression of NK cell KIR 2DL1 receptor and application of siRNA

A technology of NK cells and receptors, applied in the field of siRNA technology, can solve the problems of abnormal immune response, killing and side effects of the body, and achieve the effect of enhanced killing activity

Pending Publication Date: 2020-10-16
刘广贤
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the hinge between cells and antibodies causes the following defects in the application of this strategy: (1) repeated infusions of NK cells carrying antibodies have certain immune side effects, such as abnormal immune reactions or fever; (2) the hinge antibody NK cells have lost their natural characteristics, and when they enter the body, they are easily recognized as sick cells by the human immune system and killed, or they may also induce abnormal immune responses in the body
[0007] At present, the patent on the activation of NK cells through KIR receptor RNA interference technology only involves the activation of KIR 3DL1, which is mainly used in anti-AIDS research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • siRNA for inhibiting expression of NK cell KIR 2DL1 receptor and application of siRNA
  • siRNA for inhibiting expression of NK cell KIR 2DL1 receptor and application of siRNA
  • siRNA for inhibiting expression of NK cell KIR 2DL1 receptor and application of siRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Design steps of siRNAs that inhibit the expression of NK cell KIR receptors (2DL1, 2DL2, 2DL3):

[0032] (1) Retrieve NK cell KIR 2DL1, KIR2DL2, KIR 2DL3 gene sequences through the three gene databases of NCBI, DDBJ, and BMBL on the Internet, and obtain targeted mRNA or cDNA sequences, downstream of the cDNA transcription region +50 to +100 Sequence design siRNA sequences.

[0033] (2) Perform GEN-BAND BALST query on the selected siRNA sequence to ensure that the selected siRNA code is not homologous to other gene sequences.

[0034] A number of candidate sequences were designed for the three receptors of NK cells KIR 2DL1, 2DL2, and 2DL3, and then compared and optimized. Finally, two optimal sequences were determined for each receptor and entered into subsequent experiments.

[0035] The siRNA that inhibits the expression of NK cell KIR 2DL1 receptor includes two sequences, 2DL1-1 and 2DL1-2:

[0036] 2DL1-1 (the target site is 267 bases): the sense strand is 5'CUUCU...

Embodiment 2

[0045] (1) Synthesis of single-stranded DNA containing siRNA sequences

[0046] The DNA single strand containing the siRNA sequence is synthesized by chemical synthesis, including the DNA forward strand and the DNA reverse strand, the DNA forward strand corresponds to the sense strand of the siRNA sequence, and the DNA reverse strand corresponds to the antisense strand of the siRNA sequence. specifically,

[0047] Single-stranded DNA containing siRNA sequences that inhibit expression of the NK cell KIR 2DL1 receptor:

[0048] D1-1:

[0049] The positive chain is 5'TCGACCCCTTTCTCCATCAGTCGCATGTTCAAGAGACATGCG ACTTTTTTGGAAA3' (SEQID NO.13),

[0050] The anti-chain is 5'GATCTTTCCAAAAACTTCTCCATCAGTCGCATGTCTCTTGA ACATGCGACTGATGGG3' (SEQ ID NO. 14).

[0051] D1-2:

[0052] The positive strand is 5'TCGACCCAGTCAAGTGACCCACTGCTTTTCAAGAGAAGC AGTGGGTTTTTGGAAA3' (SEQID NO.15),

[0053] The reverse strand is 5'GATCTTTCCAAAAAAGTCAAGTGACCCACTGCTTCTCTTGAAAGCAGTGGGTCACGG3' (SEQ ID NO. 16). ...

Embodiment 3

[0142] (1) K562 cell culture

[0143] K562 cells were cultured with RPMI-1640 medium, and 5%-20% fetal bovine serum was often added during the cell culture process; the initial inoculation of cells was 1×10 6 cells / flask.

[0144] 1. When the cells cover the entire plate (100mm), discard the old culture medium and wash with 10ml PBS;

[0145] 2. Digest with 2ml of 0.25% trypsin (preheated for about 20 minutes), shake gently until the monolayer of cells falls off in lumps with the naked eye (or observe the separation of cells under a microscope), immediately add 5ml (RPMI-1640 + 10% FBS) to stop the digestion, gently pipetting 8-10 times into single cells;

[0146] 3. Centrifuge at 1000rpm*5min, discard the supernatant, add RPMI-1640+10%FBS and blow gently;

[0147] 4. Spread the cell suspension 1:4 into 100mm cell culture dishes, add 10ml (RPMI-1640 + 10% FBS) culture medium to each dish, under normal circumstances, it will be full in 2-3 days, and there is no need to chang...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The embodiment of the invention discloses siRNA for inhibiting expression of an NK cell KIR 2DL1 receptor and application of the siRNA, and belongs to the technical field of biology. The siRNA sequence is 2DL1-1 or / and 2DL1-2, wherein a positive-sense strand of the 2DL1-1 is shown as SEQ ID NO. 1, and an antisense strand of the 2DL1-1 is shown as SEQ ID NO. 2; the positive-sense strand of the 2DL1-2 is shown as SEQ ID NO. 3; and the antisense strand of the 2DL1-2 is shown as SEQ ID NO. 4. The siRNA provided by the invention can obviously and specifically inhibit the expression of the KIR 2DL1receptor, can obviously enhance the activation and killing activities of NK cells, and can be effectively applied to the prevention and treatment of viruses and tumors.

Description

technical field [0001] The embodiment of the present invention relates to the field of biotechnology, and specifically relates to an siRNA technology and its application by inhibiting the expression of NK cell KIR 2DL1 receptor. Background technique [0002] Stem cells and immune cells are the hottest cutting-edge technology fields in modern medicine. It can be said that the treatment of major diseases, common diseases, chronic diseases, aging and degenerative diseases in modern medicine will hardly make a leap without the participation of these two cells sexual progress. Among them, immune cells are the main body of human immunology and play a pillar role in the immune system. Natural killer cells (NK cells) are important members of cellular immunity and an important part of innate immunity. Because they play an important role in innate immunity, basic immunity, and immune regulation, and do not need to be activated in advance, they are The function of the human immune sy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/861C12N15/88A61K31/713A61P31/12A61P35/00
CPCA61P31/12A61P35/00C12N15/1138C12N15/86C12N15/88C12N2310/14C12N2320/32C12N2710/10343C12N2800/107
Inventor 刘广贤
Owner 刘广贤
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com