Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for accelerating protein-like propagation of tau pathology in brain of C57BL6 mouse

A mouse, pathological technology, applied in the field of biomedicine

Pending Publication Date: 2020-10-16
NANTONG UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Unfortunately, AD has always been the hardest-hit area for new drug development. The failure rate of clinical trials in this field is as high as 99.6%. In the past 20 years, the research in this field has almost been wiped out, so it is very necessary to find new targets

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for accelerating protein-like propagation of tau pathology in brain of C57BL6 mouse
  • Method for accelerating protein-like propagation of tau pathology in brain of C57BL6 mouse
  • Method for accelerating protein-like propagation of tau pathology in brain of C57BL6 mouse

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0045] 1: Outer screening for adeno-associated virus

[0046] 1. The construction of RNAi adeno-associated virus vector, the route is:

[0047] siRNA target design

[0048] Target sequence information: CTGCGAGAAGGCTAAAGAAAT, GC content (%) 42.86%

[0049] Carrier number and frame structure

[0050] GV478: U6-MCS-CAG-EGFP

[0051] RNAi Construction Framework

[0052]

[0053] synthetic fragment

[0054] Ppp2ca-RNAi-a:accggCTGCGAGAAGGCTAAAGAAATttcaagagaATTTCTTTTAGCCTTCTCGCAGttttt

[0055] Ppp2ca-RNAi-b: tctaaaaaaCTGCGAGAAGGCTAAAGAAATtctcttgaaATTTCTTTTAGCCTTCTCGCAGc

[0056] Sequencing results

[0057] PSC-1

[0058] accggCTGCGAGAAGGCTAAAGAAATttcaagagaATTTCTTTTAGCCTTCTCGCAGttttt

[0059] TGGATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCTGCGAGAAGGCTAAAGAAATTTCAAGAGAATTTCTTTAGCCTTCTCGCAGTTTTTTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for accelerating protein-like propagation of tau pathology in the brain of a C57BL6 mouse. The method comprises the following steps: constructing an RNAi adeno-associated virus vector; co-transfecting an AAV-293 cell with virus-packaged helper plasmids and the RNAi adeno-associated virus vector (a high-quality recombinant vector) of a target gene to obtain an RNAieffective vector adeno-associated virus; injecting the virus into the body of the C57BL / 6 mouse; and constructing a target gene overexpression vector, co-transfecting a 293T cell with the target geneoverexpression vector and the RNAi adeno-associated virus vector of the target gene, observing cell fluorescence to ensure that the transfection efficiency is greater than or equal to 70 percent, collecting cell extraction proteins, and detecting the knock-down condition of the target gene. According to the method, a rAAV9 gene can be used as an effective tool vector for delivering genes in braintissues, so that the protein-like propagation rate of the tau pathology in the brain of the mouse is increased.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a method for accelerating tau pathological prion-like transmission in the brain of C57BL6 mice. Background technique [0002] Alzheimer's disease (AD), commonly known as senile dementia, is a multifactorial disease, and aging is its main cause. AD has typical pathological features: the deposition of senile plaques (SP) formed by the accumulation of extracellular β-amyloid protein (Aβ) and the accumulation of a large number of tau proteins in the cells to form neurofibrillary tangles (neurofibrillary tangles). tangles, NFTs) and widespread neuronal degeneration. Aβ has always been the center in the field of AD research, and Aβ is the focus of drug development. Regrettably, AD has always been the hardest-hit area in the development of new drugs. The failure rate of clinical trials in this field is as high as 99.6%. In the past 20 years, the research in this field ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/864C12N15/54C12N5/10A01K67/027
CPCC12N15/86C12N9/12C12Y207/11A01K67/0276C12N2750/14143A01K2217/075A01K2227/105A01K2267/0312A01K2267/0393
Inventor 周艳
Owner NANTONG UNIVERSITY