Salmonella mutant strain capable of efficiently stimulating immune responses and construction method and application of salmonella mutant strain

A technology of immune response and construction method, applied in the field of bioengineering, can solve problems such as limiting the application effect of Shigella vaccine and immune failure

Active Publication Date: 2020-10-20
NANCHANG UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing studies have discovered some potential candidate vaccine targets, among which lipopolysaccharide (Lipopolysaccharide) of Shigella can show better protection, and some studies have proved that the complex of Shigella lipopolysaccharide and protein can stimulate small Rats have a high serum antibody titer and can show a certain degree of protection. Clinical experiments have shown that Shigellaflexneri 2a (Shigellaflexneri 2a) O antigen polysaccharide can cause specific immune protection, but the most critical problem of lipopolysaccharide is to enter the host body , cannot effectively reach the host immune system and be recognized by the immune system, which may lead to immune failure with a certain probability
This defect greatly limits the application effect of Shigella vaccines in actual clinical practice. Therefore, the development of new vaccines is imminent. How to develop new vaccines that can effectively stimulate the host to produce an immune response is an urgent issue. solve

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Salmonella mutant strain capable of efficiently stimulating immune responses and construction method and application of salmonella mutant strain
  • Salmonella mutant strain capable of efficiently stimulating immune responses and construction method and application of salmonella mutant strain
  • Salmonella mutant strain capable of efficiently stimulating immune responses and construction method and application of salmonella mutant strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0098] Construction method of mutant strain:

[0099] Using the Salmonella typhimurium UK-1 strain as a template, the gene was knocked out to construct the mutant strain QS001 (ΔfliCΔfljBΔompAΔompCΔompD). The outer membrane vesicles were purified and verified by SDS-PAGE that there was no flagellin and OmpACD in the outer membrane vesicles. After the successful construction was verified, the mutation (ΔrfbP) that truncated the LPS O antigen chain was introduced into the mutant strain QS001 to construct the O antigen mutant strain, and the constructed LPS map was identified by PCR and silver staining (Sliver staining). mutant strains.

experiment example 1

[0101] Construction of plasmids expressing LPS, S. flexneri 2a O-antigen gene cluster:

[0102] 1. ΔfilC primer design and PCR amplification

[0103] According to the reported Salmonella S100 strain sequence, (with reference to the GenBank sequence number is GCF_000006945), two pairs of fusion PCR primers were designed to amplify the upstream homology arm and the downstream homology arm of the filC gene respectively, and the size of the amplified fragment was 300bp. Synthesized by Beijing Huada Gene Company, the primer sequence is as follows:

[0104] fliC-1F: CGTTCTTTGTCAGGTCTGTC

[0105] fliC-1R: GATTAGCGGCCGCGATCTTTTCCTTATCAATTA

[0106] fliC-2F:AAGATCGCGGCCGCTAATCCGGCGATTGATTCAC

[0107] fliC-2R: TGTACCCGGCACAGACGGTC

[0108] 2. Amplification of the upper and lower homology arms of the Salmonella filC gene

[0109] Prepare the genomic DNA template of Salmonella typhimurium S100 by boiling and lysis method: Pick a single colony of Salmonella typhimurium S100 and cultur...

Embodiment 2

[0119] 1. ΔfljB primer design and PCR amplification

[0120]According to the reported Salmonella S100 strain sequence, (with reference to the GenBank sequence number is GCF_000006945), two pairs of fusion PCR primers were designed to amplify the upstream homology arm and the downstream homology arm of the fljB gene respectively, and the size of the amplified fragment was 300bp. Synthesized by Beijing Huada Gene Company, the primer sequence is as follows:

[0121] fljB-1F:AGTGAGCTCCACGTTCATGT

[0122] fljB-1R:AATTAGCGGCCGCAAAATTTTCCTTTTGGAAGG

[0123] fljB-2F: ATTTTGCGGCCGCTAATTTATTTCGTTTTATTC

[0124] fljB-2R:GTCATTACCTGATAATTCTTC

[0125] 2. Amplification of the upper and lower homology arms of the Salmonella fljB gene

[0126] Prepare the genomic DNA template of Salmonella typhimurium S100 by boiling and lysis method: Pick a single colony of Salmonella typhimurium S100 and culture it overnight in LB medium at 37°C, take 0.5ml of the bacterial liquid and centrifuge at 120...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a salmonella mutant strain capable of efficiently stimulating hosts to produce immune responses against shigella flexneri 2a serotype O antigen polysaccharides, and a construction method and an application of the salmonella mutant strain, and belongs to the technical field of bioengineering. The provided salmonella mutant strain has the following gene deletion mutations delta-fliC, delta-fljB, delta-ompA, delta-ompC and delta-ompD, a gene rfbP that is conducive to expression of heterologous O antigen polysaccharides is knocked out, and at the same time, expression plasmids capable of completely expressing the shigella flexneri O antigen polysaccharides are transferred. A preservation number of the salmonella mutant strain is CCTCC NO:M 2020142 and the salmonella mutant strain is preserved in the China Center for Type Culture Collection. By modifying an outer membrane structure of the salmonella, the salmonella mutant strain is more efficient to be used asa polysaccharide presentation carrier. At the same time, the O antigen polysaccharides of the shigella flexneri are expressed in the outer membrane of the salmonella, outer membrane vesicles are purified, the salmonella mutant strain can efficiently stimulate the hosts to produce the immune responses and secrete the outer membrane vesicles, thereby presenting heterologous polysaccharide antigen as a vaccine, and the salmonella mutant strain can be effectively used for prevention and treatment of shigella infection.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a Salmonella mutant strain that efficiently stimulates a host to produce an immune response against Shigella O antigen polysaccharide, a construction method and an application. Background technique [0002] Shigella spp. is a highly infectious and pathogenic Gram-negative bacteria that can cause severe diarrhea and even death in humans, commonly known as Shigella, and is the most common cause of human bacillary dysentery. pathogenic bacteria. Dysentery is a kind of enteric infectious disease with high incidence worldwide. According to conservative estimates, the number of infected people in the world exceeds 160 million every year, and the number of deaths exceeds 1.1 million. Dysentery is especially common in developing countries. [0003] Shigella bacteria are divided into four groups. Group A: Shigella dysenteriae (Sh.dysenteriae), commonly known as Shigel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/74C12N15/90C12N15/31A61K39/112A61P31/04C12R1/42
CPCC07K14/255C07K14/25C12N15/74C12N15/902A61K39/0283A61P31/04Y02A50/30
Inventor刘琼黄孝天李标先曾令兵
OwnerNANCHANG UNIV