Salmonella mutant strain capable of efficiently stimulating immune responses and construction method and application of salmonella mutant strain
A technology of immune response and construction method, applied in the field of bioengineering, can solve problems such as limiting the application effect of Shigella vaccine and immune failure
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0098] Construction method of mutant strain:
[0099] Using the Salmonella typhimurium UK-1 strain as a template, the gene was knocked out to construct the mutant strain QS001 (ΔfliCΔfljBΔompAΔompCΔompD). The outer membrane vesicles were purified and verified by SDS-PAGE that there was no flagellin and OmpACD in the outer membrane vesicles. After the successful construction was verified, the mutation (ΔrfbP) that truncated the LPS O antigen chain was introduced into the mutant strain QS001 to construct the O antigen mutant strain, and the constructed LPS map was identified by PCR and silver staining (Sliver staining). mutant strains.
experiment example 1
[0101] Construction of plasmids expressing LPS, S. flexneri 2a O-antigen gene cluster:
[0102] 1. ΔfilC primer design and PCR amplification
[0103] According to the reported Salmonella S100 strain sequence, (with reference to the GenBank sequence number is GCF_000006945), two pairs of fusion PCR primers were designed to amplify the upstream homology arm and the downstream homology arm of the filC gene respectively, and the size of the amplified fragment was 300bp. Synthesized by Beijing Huada Gene Company, the primer sequence is as follows:
[0104] fliC-1F: CGTTCTTTGTCAGGTCTGTC
[0105] fliC-1R: GATTAGCGGCCGCGATCTTTTCCTTATCAATTA
[0106] fliC-2F:AAGATCGCGGCCGCTAATCCGGCGATTGATTCAC
[0107] fliC-2R: TGTACCCGGCACAGACGGTC
[0108] 2. Amplification of the upper and lower homology arms of the Salmonella filC gene
[0109] Prepare the genomic DNA template of Salmonella typhimurium S100 by boiling and lysis method: Pick a single colony of Salmonella typhimurium S100 and cultur...
Embodiment 2
[0119] 1. ΔfljB primer design and PCR amplification
[0120]According to the reported Salmonella S100 strain sequence, (with reference to the GenBank sequence number is GCF_000006945), two pairs of fusion PCR primers were designed to amplify the upstream homology arm and the downstream homology arm of the fljB gene respectively, and the size of the amplified fragment was 300bp. Synthesized by Beijing Huada Gene Company, the primer sequence is as follows:
[0121] fljB-1F:AGTGAGCTCCACGTTCATGT
[0122] fljB-1R:AATTAGCGGCCGCAAAATTTTCCTTTTGGAAGG
[0123] fljB-2F: ATTTTGCGGCCGCTAATTTATTTCGTTTTATTC
[0124] fljB-2R:GTCATTACCTGATAATTCTTC
[0125] 2. Amplification of the upper and lower homology arms of the Salmonella fljB gene
[0126] Prepare the genomic DNA template of Salmonella typhimurium S100 by boiling and lysis method: Pick a single colony of Salmonella typhimurium S100 and culture it overnight in LB medium at 37°C, take 0.5ml of the bacterial liquid and centrifuge at 120...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


