Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of miRNA 148 cluster as marker for diagnosis and/or treatment of cognitive disorder related diseases

A technology for cognitive impairment and diseases, applied in DNA/RNA fragments, gene therapy, neurological diseases, etc., can solve the problems of complex pathogenesis, lack of early diagnosis and screening methods, and difficulty in disease screening and prevention.

Active Publication Date: 2020-11-20
MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The pathogenesis of these two diseases is relatively complicated, there is a lack of drugs with good therapeutic effects, and there is a lack of simple and non-invasive early diagnosis and screening methods. Therefore, seeking reliable diagnostic markers and effective therapeutic drugs is an urgent science to be solved for the prevention and treatment of AD and VaD. question
However, most AD and VaD have no relevant gene reports, which brings great difficulty to the screening and prevention of diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miRNA 148 cluster as marker for diagnosis and/or treatment of cognitive disorder related diseases
  • Application of miRNA 148 cluster as marker for diagnosis and/or treatment of cognitive disorder related diseases
  • Application of miRNA 148 cluster as marker for diagnosis and/or treatment of cognitive disorder related diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1, miRNA chip technology detects the differential expression of miR-148a in the brain tissue of AD model animals and wild-type animals

[0060] RNA was extracted from the brain tissues of 1, 3, 6, and 9-month-old APP / PS1 double transgenic mice and their wild-type control mice, and miRCURY was used to TM Array Power Labeling kit fluorescently labels miRNA. The microRNA of the miRNA 148 cluster of the present invention is hsa-miR-148a, and its sequence is shown in SEQ ID NO.1: gaggcaaagu ucugagacacuccgacucug aguaugauag aagucagugc acuacagaac uuugucuc. Its default mature body (hsa-miR-148a-3p) sequence is shown in SEQ ID NO.2: ucagugcacuacagaacuuugu. Among them, mature (hsa-miR-148a-3p) miRNA reverse transcription primer: SEQ ID NO.3: gtcgtatcca gtgcagggtc cgaggtattcgcactggata cgacacaaag; qPCR forward primer: SEQ ID NO.4: gcgcgtcagt gcactacagaa; reverse primer: SEQ ID NO .5: agtgcagggt ccgaggtatt. The samples were then compared with miRCURY TM Array chip hybri...

Embodiment 2

[0061] Example 2, expression changes of miR-148a in AD model cells

[0062] The Swedish-type mutant APP gene was stably transfected into SH-SY5Y cells to construct a stably transfected APPswe cell line. In the present invention, 300 μM copper ions are used to damage APPswe cells to establish an AD cell model, and cell RNA is extracted to detect the expression level of miR-148a. Such as figure 2 As shown in middle A, compared with the normal control SH-SY5Y cells, the expression of miR-148a in AD model cells was significantly down-regulated (mean±SEM, n=3, *P<0.05).

Embodiment 3

[0063] Example 3, the expression changes of miR-148a in AD model animals and natural aging animals

[0064] The expression levels of miR-148a in the brains of APP / PS1 double transgenic mice and their wild-type (WT) control mice, SAMP8 mice and their control mice (SAMR1) were detected by qPCR. Such as figure 2 As shown in middle B-C, in the cortex and hippocampus of 3, 6, and 9-month-old APP / PS1 mice, the expression level of miR-148a showed a downward trend, and the 6- and 9-month-old APP / PS1 mice There were statistical differences compared with mice (mean±SEM, n=4, *P figure 2 As shown in D-E, in the hippocampus of SAMP8 mice, only the expression level of miR-148a in the hippocampus of 9-month-old mice was significantly lower than that of SAMR1 controls at the same age (mean±SEM, n=4, *P<0.05); In the cortex, the miR-148a expression levels of 6- and 9-month-old SAMP8 mice were significantly lower than those of SAMR1 control mice (mean±SEM, n=4, *P<0.05, ***P<0.001). It was ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of an miRNA 148 cluster as a marker for diagnosis and / or treatment of cognitive disorder related diseases. The invention provides the application of miRNA 148 cluster microRNA in diagnosis and treatment of cognitive disorder related diseases, and the expression quantity of the miRNA 148 cluster microRNA is detected through a cognitive disorder disease model by using a primer of a microRNA marker aiming at the miRNA 148 cluster. It is found that expression of microRNA of the miRNA 148 cluster is remarkably reduced in the course of cognitive disorder related diseases, tau protein overphosphorylation in AD lesions is inhibited through negative regulation of the PTEN gene and targeting of p35, and the AD pathology course is improved. Therefore, the microRNA of the miRNA 148 cluster can be used as a novel marker of cognitive disorder related diseases and is used for auxiliary diagnosis and treatment of the cognitive disorder related diseases.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of the miRNA148 cluster as a marker for diagnosing and / or treating cognitive impairment-related diseases. Background technique [0002] Neurocognitive disorders (NCDs) are a group of syndromes characterized by cognitive deficits, involving impairments in thinking, reasoning, memory, and problem solving. According to the fifth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5), it is divided into mild cognitive impairment and severe cognitive impairment (dementia). Cognitive impairment involves many brain and physical diseases, among which Alzheimer's disease (AD) and vascular dementia (VaD) are the most common cognitive impairment-related diseases. While cognitive impairment is more likely to affect older adults, it is not part of the normal aging process but a disease of underlying pathological damage to the brain, and thus affects younger ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/7105A61P25/00A61P25/28C12Q1/6883A61K45/00
CPCA61K31/7105A61P25/00A61P25/28C12Q1/6883A61K45/00C12Q2600/158C12Q2600/178C12N2310/141C12N15/113C12N2310/14C12Y301/03048C12N2320/30C12N2320/51
Inventor 刘睿李卓荣姜海伦曾利王琳琳
Owner MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More