Unlock instant, AI-driven research and patent intelligence for your innovation.

Medicine for preventing oxidative stress of retinal ganglion cells and wet macular degeneration

A retinal ganglion and drug technology, which can be used in drug combinations, sensory diseases, pharmaceutical formulations, etc., can solve problems such as DNA tetrahedron or miR-155 that have not yet been seen, and achieve good application prospects, prevention of cell apoptosis, and good protection. Effect

Active Publication Date: 2020-12-01
CHENGDU GENREZE GENE TECH CO LTD
View PDF6 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] There are no reports of DNA tetrahedron or miR-155 being used to prevent oxidative stress in retinal ganglion cells or wet AMD

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Medicine for preventing oxidative stress of retinal ganglion cells and wet macular degeneration
  • Medicine for preventing oxidative stress of retinal ganglion cells and wet macular degeneration
  • Medicine for preventing oxidative stress of retinal ganglion cells and wet macular degeneration

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Synthesis of embodiment 1 tFNA

[0040] 1. Synthesis method

[0041] Dissolve four DNA single strands (S1, S2, S3, S4) in TM Buffer (10mM Tris-HCl, 50mM MgCl 2 ,pH=8.0), the final concentration of the four DNA single strands was 1000nM, mixed thoroughly, rapidly heated to 95°C for 10 minutes, then rapidly cooled to 4°C and maintained for more than 20 minutes to obtain tFNA.

[0042] The sequences of the four single strands (5'→3') are as follows:

[0043] S1: ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGA

[0044] GACGAACATTCCTAAGTCTGAA (SEQ ID NO. 1);

[0045] S2: ACATGCGAGGGTCCAATACCGACGATTACAGCTGCTACAC

[0046] GATTCAGACTTAGGAATGTTCG (SEQ ID NO. 2);

[0047] S3: ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATC

[0048] GACGGGAAGAGCATGCCCATCC (SEQ ID NO. 3);

[0049] S4: ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATAC

[0050] GAGGATGGGCATGCTCTTCCCG (SEQ ID NO. 4).

[0051] The 5' end of S1 is optionally connected with a Cy5 fluorescent labeling group for tFNA tracking.

[0052...

Embodiment 2

[0057] Synthesis of the complex (TDN-155) of embodiment 2 tFNA and miR-155

[0058] 1. Synthesis

[0059] On the basis of Example 1, replace the S3 sequence with the S-S3 sequence, and synthesize tFNA. The S-S3 sequence is as follows:

[0060] ttgacctgtgaattACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC (SEQ ID NO.5); the lowercase part is the linker sequence, which is used for complementary pairing with the linker on the miRNA.

[0061] Then, the miR-155 double-stranded molecule with adapter was incubated with tFNA for half an hour at room temperature. The molecular sequence of the double-stranded RNA is:

[0062] Sense strand: uucacaggucaa UUAAUGCUAAUUGUGAUAGGGGU (SEQ ID NO.6, the linker is lowercase),

[0063] Antisense strand: CCCUAUCACAAUUAGCAUUAAUU (SEQ ID NO.7)

[0064] 2. Identification

[0065] After synthesis, the complex was detected by electrophoresis, and it was found that the complex of tFNA and miR-155 had a slight tailing phenomenon compar...

experiment example 1

[0067] Experimental example 1 Cell uptake experiment

[0068] 1. Method

[0069] RGC-5 cells (a mouse retinal ganglion cell) were grouped and exposed to the Cy5-labeled tFNA (125nM) prepared in Example 1 for 1h, 2h and 3h, and the blank group (i.e. not used tFNA treatment) comparison. All groups were washed 3 times with phosphate buffer, and detected by flow cytometry.

[0070] 2. Results

[0071] Such as Figure 4 As shown in A, within 3 h of treatment, the fluorescence intensity increased significantly with the treatment time, indicating that tFNA was easily taken up by RGC-5 cells rapidly.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a medicine for preventing retinal ganglion oxidative stress. The medicine is a preparation prepared by taking a DNA tetrahedron as an active component and adding pharmaceutically acceptable auxiliary materials or auxiliary components. The invention also provides application of the DNA tetrahedron in preparation of the medicine for preventing oxidative stress of retinal ganglion cells and apoptosis. The tFNA is used for preparing the medicine for preventing oxidative stress of the retinal ganglion cells, is helpful for treating diseases caused by oxidative stress of the retinal ganglion cells such as glaucoma, and has a very good application prospect.

Description

technical field [0001] The invention relates to the field of retinal nerve medicine. Background technique [0002] Oxidative stress (OS) refers to a state of imbalance between oxidation and anti-oxidation in the body, which tends to oxidize, leading to inflammatory infiltration of neutrophils, increased secretion of proteases, and production of a large number of oxidized intermediates. Oxidative stress is a negative effect of free radicals in the body and is believed to be an important factor in aging and disease. [0003] Retinal ganglion cells are cells located in the innermost layer of the retina, whose main function is to receive electrical impulses transmitted from cones and rods to bipolar cells, and to transmit electrical impulses to the optic nerve to produce vision. Oxidative stress in retinal ganglion cells is involved in the pathological process of many diseases, including glaucoma, diabetes, age-related macular degeneration, optic nerve damage, etc. When retina...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/711A61K31/7105A61P27/02A61P39/06A61P27/06
CPCA61K31/7105A61K31/711A61P27/02A61P27/06A61P39/06A61K2300/00
Inventor 林云锋李妮秦鑫蔡潇潇
Owner CHENGDU GENREZE GENE TECH CO LTD