Supercharge Your Innovation With Domain-Expert AI Agents!

Oocyte function recovery preparation for TRIP13 gene mutation induced oocyte maturation defect and use method of oocyte function recovery preparation

A preparation and egg technology, applied in the field of egg function recovery preparations for egg maturation disorders

Inactive Publication Date: 2021-02-09
FUDAN UNIV +1
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these two gene mutations can only explain a very small number of patients with egg maturation disorders. We recently found that TRIP13 mutations exist in multiple patients with egg maturation disorders (Zhang et al. Bi-allelic Missense Pathogenic Variants in TRIP13 Cause Female Infertility Characterized by Oocyte Maturation Arrest . Am J Hum Genet. 2020;107(1):15-23)
In addition, in the current clinical practice of assisted reproduction, there is no method to improve and treat patients with oocyte maturation disorders.
However, there are no reports of gene therapy applied to reproductive diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0032] Example: Ovum function recovery of patient A with ovum maturation disorder

[0033] (1) preparation preparation:

[0034] The TRIP13 gene cDNA was used as a template to amplify the coding region of TRIP13 (including the stop codon) by PCR, and the PCR product was purified and used as a template to construct the vector pCMV6 after double digestion with SfaAI and MluI, and the vector was single-digested with AgeI. Transcribed into cRNA of TRIP13 in vitro, and diluted its concentration to 500ng / ul;

[0035] TRIP13cRNA preparation prepares PCR amplification primer pair as follows:

[0036] hTRIP13-SfaAI-F: GAGGCGATCGCATGGACGAGGCCGTGGGCGAC

[0037] hTRIP13-TGA-MluI-R: GCGACGCGTTCAGATGTAAGCTGCAAGCTTCT;

[0038] (2) How to use:

[0039] The patient with egg maturation disorder came from the reproductive center of a university affiliated hospital in Shanghai, China; the female patient’s female reproductive organs, ovarian function, sex hormones, and ovulation were all normal;...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene therapy, and particularly relates to an oocyte function recovery preparation for TRIP13 gene mutation induced oocyte maturation defect and a use method of the oocyte function recovery preparation. Clinical manifestations of patients with oocyte maturation defect are that in a test tube baby operation, most of the patients cannot obtain mature oocytes or the mature oocytes are low in fertilization rate and free of effective embryos after excretion promotion, so that test tube babies repeatedly fail. The invention provides the oocyte functionrecovery preparation for CDC20 gene mutation induced oocyte maturation defect. The preparation is prepared from TRIP13cRNA or TRIP13 protein with a certain concentration. The preparation is injected into the oocytes of the patients, so that the oocytes of the patients complete a maturation process or the fertilization rate is remarkably improved, effective embryos can be obtained, and pregnancy isfinally established.

Description

technical field [0001] The invention belongs to the technical field of gene therapy, and in particular relates to an oocyte function recovery preparation for oocyte maturation disorder caused by TRIP13 gene mutation and a use method thereof. Background technique [0002] Mature sperm and egg produce totipotent zygote through normal fertilization, which is the key link of successful human reproduction. Therefore, egg maturation disorder can lead to female infertility and repeated failure of clinical assisted reproduction. Clinically, the phenotype of egg maturation disorder mainly includes that the eggs are never mature or the fertilization rate of mature eggs is low. Patients need to retrieve eggs multiple times to obtain very few effective embryos or despite multiple egg retrievals, they still cannot obtain effective embryos. At present, genes such as TUBB8 and PATL2 have been found to be related to egg maturation disorders. However, these two gene mutations can only expl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/10C12N15/866C12N5/075A61K48/00A61K38/17A61P15/08
CPCC12N15/85C12N15/10C12N15/86C12N5/0609C07K14/47A61K48/005A61K38/1709A61P15/08C12N2800/107C12N2800/105C12N2510/00C12N2517/10C12N2710/14043
Inventor 王磊匡延平桑庆
Owner FUDAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More