Humanized anti-chikungunya virus NSP1 antibody and application thereof
A chikungunya virus and monoclonal antibody technology, applied in antiviral agents, virus/bacteriophage, antiviral immunoglobulin, etc., to achieve high affinity and high specificity effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Preparation and screening of mouse monoclonal antibody CH001
[0027] 1) Application of hybridoma technology to prepare anti-NSP 1 For monoclonal antibodies, the specific steps are as follows:
[0028] 1. Preparation of antigen (NSP 1 Recombinant protein)
[0029] Construction of NSP1 expression plasmid:
[0030] PCR amplified gene sequence,
[0031] (F(5'-3'): TAGAGCTAGCGAATTCGAATTCCACCATGGAGACCGATACC;
[0032] R (5'-3'): TTGCGGCCGCGGATCCGCGGCCGCTTATCACTTGC), restriction endonucleases EcoRI and NotI digested the target fragment and expression plasmid pET28a respectively, recovered the target fragment and vector fragment by gel, ligated overnight at 16°C according to the ratio, and transformed E. coli DH5α. The positive clones were identified by colony PCR screening, and the plasmids were extracted for double enzyme digestion identification and sequencing.
[0033] Retransform Escherichia coli BL-21(DE3) competent cells with the plasmids that have been d...
Embodiment 2
[0045] Example 2hm NSP 1 Antibody preparation
[0046] After the applicant's previous detection of murine monoclonal antibody, we selected the CH001 hybridoma cell line to prepare the human-mouse chimeric antibody hm CH001.
[0047] 1) Amplification and verification of antibody variable region gene fragments:
[0048] CH001 hybridoma cells were cultured to the logarithmic growth phase, and the total RNA of the cells was extracted by Trizol-chloroform-isopropanol; the dried total RNA of the cells was dissolved in 20 μL of water, and the OD260 / OD280 was measured, and the value was 1.9. Take 14 μL of RNA for reverse transcription, use the mRNA in the total RNA as a template, and use OligodT 15 Single-stranded cDNA was obtained by reverse transcription and amplification.
[0049] Design 19 VH upstream primers and 17 Vκ upstream primers, 4 VH downstream primers and 3 Vκ downstream primers Primers:
[0050] Vκ5' upstream primer:
[0051] Vκ-1
[0052] 5’-GGG CCC AGG CGG CCG AG...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More