A method of using gene editing technology to create corn dwarfing materials

A gene editing and corn technology, applied in the field of genetic engineering, can solve the problems of reducing yield, limiting the application effect of improved materials, and taking a long time to achieve the effect of reducing plant height

Active Publication Date: 2022-06-24
JILIN ACAD OF AGRI SCI
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] The improvement of corn production in the 20th century mainly relied on increasing the planting density of corn per unit area. However, if the density is too high, there will be the risk of lodging, which may reduce the yield. Therefore, reducing the plant height of corn to a certain extent will help improve corn yield
[0003] The creation of traditional dwarf maize is mainly through the method of backcrossing, which often requires 6 backcrossing generations, which is not only time-consuming, but also often accompanied by gene redundancy, which leads to the introduction of some non-target traits and limits the application of improved materials Effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method of using gene editing technology to create corn dwarfing materials
  • A method of using gene editing technology to create corn dwarfing materials

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Construction of gene editing vector

[0035] (1) The gene that controls the plant height of maize is the ZmGA3ox1 gene, and its nucleotide sequence is as follows:

[0036]ATGCCGACGCCGTCGCACCTCAACAAGAACCCGCGCTACCTGGACTTCCGGGCGGCGCGGCGGGTGCCGGAGTCGCACGCCTGGCCGGGCCTGCACGACCACCCCGTCGTGGACGGCGGCGCGCCGGGCCCCGACGCCGTGCCGGTGGTGGACCTGGGCGCCGCGGACCCGGCGCCGGCGCCGGCGGCGGCGGTGGCCCGCGCCGCCGAGCAATGGGGCGCGTTCCTGCTCACGGGCCACGGCGTCCCCGCGGACCTGCTGGCGCGCGTGGAGGACCGGATCGCCACCATGTTCGCGCTGCCGGCCGACGACAAGATGCGCGCCGTGCGCGGGCCCGGCGACGCCTGCGGCTACGGCTCCCCGCCCATCTCCTCCTTCTTCTCCAAGTGCATGTGGTCCGAGGGCTACACCTTCTCGCCGGCCTCCCTCCGCGCCGACCTCCGCAAGCTCTGGCCCAAGGCCGGCGACGACTACACCAGCTTCTGTGATGTGATGGAGGAGTTCCACAAGCACATGCGCGCCCTCGCGGACAAGCTGCTGGAGCTGTTCCTCATGGCGCTGGGGCTCACCGACGAGCAGGCCAGCGCCGTCGAGGCCGAGCGGAGGATCGCCGAGACGATGACCGCCACCATGCATCTCAACTGGTACCCGAGGTGCCCGGACCCGCGGCGCGCGCTGGGGCTGATCGCGCACACCGACTCGGGCTTCTTCACCTTCGTGATGCAGAGCCTCGTGCCCGGGCTGCAGCTCTTCCGCCACGCCCCGGACCGGTGGGTGGCGGTGCCGGCCGTGCCGGGCGCCTTCG...

Embodiment 2

[0053] Example 2 The gene editing vector was transformed into Agrobacterium LBA4404

[0054] 1) CaCl 2 Preparation of Agrobacterium tumefaciens competent cells

[0055] (1) From the YEP plate (Rif R ,Str R ), pick a fresh single colony of EHA105 and inoculate it in YEP liquid medium containing 50mg / L Str and 25mg / L Rif, 28°C, 220rpm shaking culture overnight for 24-36h;

[0056] (2) Take 2ml of overnight activated bacterial liquid in the logarithmic growth phase, inoculate it in 50mL YEP liquid medium, and cultivate the bacterial liquid OD at 20°C 600 to about 0.4 to 0.6;

[0057] (3) Transfer the bacterial liquid to an ice-precooled 50 mL sterile centrifuge tube, ice bath for 30 min, centrifuge at 4,000×g for 10 min at 4°C, and enrich the bacterial cells;

[0058] (4) Pre-cool 0.05M CaCl with 10mL ice 2 Suspend the bacterial cells, take an ice bath for 30 min, centrifuge at 4,000 × g for 10 min at 4 °C, and enrich the bacterial cells;

[0059] (5) Pre-chill 0.05M CaCl ...

Embodiment 3

[0072] Example 3 Maize genetic transformation

[0073] (1) The material for embryo extraction was the corn inbred line C01. The young maize embryos were observed on the ninth day after pollination. When the embryos grew to about 1.5 mm, the ear was taken back to the laboratory for embryo extraction.

[0074] (2) Prepare the Agrobacterium infection solution, when the activated Agrobacterium is shaken to a specific concentration (OD) in the YEB liquid medium 550 = 0.5), collect the cell pellet by low-speed centrifugation, and then use inf (per liter composition: N6 salt and vitamin (sigma) 2 g, sucrose 68.5 g, glucose 36 g, L-proline 0.7 g, MES 0.5 g, 1 mg / ml 2,4-D 1.5ml)+AS (Acetosyringone, (100mM), 1ml)) liquid medium to resuspend, shake at 75r / min at 25°C for 24h, until the concentration is OD 550 =0.3-0.4.

[0075] (3) The immature embryos taken out in (1) were washed twice with inf+AS (same as above) liquid medium, and then Agrobacterium infection solution was added to infe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for creating a corn dwarfing material by using gene editing technology, and belongs to the technical field of genetic engineering. The invention discloses a method for creating corn dwarfing materials using gene editing technology, which uses CRISPR / Cas9 technology to edit the corn ZmGA3ox1 gene, and further screens to obtain mutant materials lacking the function of the target gene. These corn dwarfing materials have important breeding value.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for creating maize dwarfing materials by using gene editing technology. Background technique [0002] The increase of corn yield in the twentieth century mainly depends on increasing the planting density of corn per unit area. However, if the density is too high, there is the risk of lodging, which may reduce the yield. Therefore, reducing the corn plant height to a certain extent will help improve the corn yield. In the late 1960s, the famous "Green Revolution" set off a craze for semi-dwarf plants to increase yields. High-yielding varieties of semi-dwarf rice and wheat were successfully created during the "Green Revolution". Many maize dwarf mutants have been identified in the past few decades, but not fully applied to maize breeding. [0003] The creation of traditional dwarf maize is mainly through the method of backcrossing, which often requires 6 bac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/84C12N15/55C12N15/53A01H5/04A01H6/46
CPCC12N15/8218C12N15/8261C12N15/8297C12N9/22C12N9/0071C12Y114/11015
Inventor宋广树吕庆雪李毅丹孙蕾高嵩
OwnerJILIN ACAD OF AGRI SCI