Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of LETM2 to prevention and treatment of obesity

An obesity and activity technology, applied in the direction of gene therapy, medical preparations containing active ingredients, biochemical equipment and methods, etc., can solve the problems of lack of effective drugs and treatment methods, and achieve enhanced activity, increased energy consumption, accelerated The effect of fat consumption

Active Publication Date: 2021-05-14
CHINA AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, there is still a lack of effective drugs and treatments for this problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of LETM2 to prevention and treatment of obesity
  • Application of LETM2 to prevention and treatment of obesity
  • Application of LETM2 to prevention and treatment of obesity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Through the GEO database (NCBI, GEO accession GSE66921), the inventor found that the expression of LETM2 in the adipose tissue of obese patients was reduced ( figure 1 ).

Embodiment 2

[0023] RT-qPCR detected the mRNA expression levels of brown fat-related genes in wild-type mice, LETM2KO mice and LETM2 OE mice, and found that compared with wild-type mice, brown fat-related genes Ucp1, Pgc1α, Cidea, Dio2 and The expression of Pparγ was significantly increased ( figure 2 ).

[0024] Identify primers:

[0025] Ucp1-F: aggcttccagtacccattaggt

[0026] Ucp1-R: ctgagtgaggcaaagctgattt

[0027] Pgc1α-F: tatggagtgacatagagtgtgct

[0028] Pgc1α-R: ccacttcaatccaccccagaaag

[0029] Cidea-F: tgacattcatggattgcagac

[0030] Cidea-R: ggccagttgtgatgactaagac

[0031] Dio2-F: gatgctcccaattccagtgt

[0032] Dio2-R: tgaaccaaagttgaccacca

[0033] Pparγ-F: ggaagaccactcgcattcctt

[0034] Pparγ-R: gtaatcagcaaccattgggtca

Embodiment 3

[0036] Wild-type mice, LETM2KO mice and LETM2 OE mice were fed with high-fat diet (HFD, 60% kal, D12492, Research Diets Inc) for 14 weeks, and the body weight changes of the mice were recorded every week. It was found that compared with wild-type mice, LETM2KO mice gained weight, but LETM2 OE mice significantly decreased body weight ( image 3 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a novel application of LETM2, and the LETM2 is used for preparing a medicine for preventing and treating obesity. The novel application of the LETM2 also comprises application of the LETM2 to prevention and treatment of obesity and other metabolism-related diseases. The invention provides a new strategy for treating metabolic diseases, that is to say, the energy consumption of brown adipose tissue is regulated by inhibiting or enhancing the activity of LETM2 so as to treat metabolic related diseases. The invention also provides a new target for preventing and treating obesity and other related metabolic diseases, including a signal pathway related to LETM2, so as to be used for treating obesity and other related metabolic diseases.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of LETM2 as a target for obesity prevention and treatment by regulating the activity of brown adipose tissue. Background technique [0002] Obesity has become a global epidemic and is a major risk factor for several metabolic syndromes including type 2 diabetes characterized by hyperglycemia and insulin resistance, cardiovascular disease, hypertension and many types of cancer. [0003] In recent years, the number of obese patients in China has increased rapidly, and it will become the country with the largest number of obese patients in the world in the future, with about 114 million people suffering from obesity. Obesity results from a long-term imbalance in energy metabolism, where energy intake from food exceeds energy expenditure. Obesity increases the risk of various diseases, including T2D (type 2 diabetes), hypertension, hyperlipidemia, non-alcoholic fatty liv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K45/00A61K48/00A61P3/04C12Q1/6883C12N15/11
CPCA61K45/00A61K48/005A61P3/04C12Q1/6883C12Q2600/158
Inventor 李向东宋润杰
Owner CHINA AGRI UNIV
PatSnap Eureka logo

PatSnap Eureka turns technology decisions into work you can execute. Powered by our Innovation Knowledge Graph, it runs expert workflows across engineering, life sciences, materials and intellectual property. Get your review-ready output in minutes.

X (Twitter)LinkedInYouTubeSubstack

© 2026 PatSnap. All rights reserved. 

Terms of Service

 | 

Privacy policy

 | 

Modern Slavery Act Transparency Statement