Myristoylated polypeptide for coding mitochondrial localization as well as preparation method and application of myristoylated polypeptide
A technology of myristoylation and mitochondria, which is applied in the field of molecular genetics, can solve the problems that foreign proteins cannot be imported into mitochondria, and achieve the effect of promoting combination
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Sequence screening and confirmation of myristoylated mitochondria-localized peptides:
[0024] (1) The myristoylation conserved sequence is derived from the front sequence of protein MARCKS: MGAQFSK.
[0025] The corresponding nucleotide is: ATGGGTGCCCAGTTCTCCAAG.
[0026] (2) Customize PCR primers for the GluN1 C0 region with myristoylation conserved sequence, the sequence of which is as follows:
[0027] GluN1: 5'-3' (with myristoylation conserved sequence): TCGGCTAGCACCATGGGTGCCCAGTTCTCCAAGATCGCCTACAAGCGACACAAGGATGCC; 3'-5': AGCTGTCGACCTGCAGGTTCTTCCTCCACACGTTCAC.
[0028] (3) The GluN1 plasmid was used as a template for conventional PCR. (The PCR kit was purchased from TaKaRa Co., Ltd.) system. The PCR system (25 μL) is as follows (unit: μL):
[0029] 10×Buffer: 2.5,
[0030] dNTP: 2,
[0031] Taq: 0.5;
[0032] primer: 2;
[0033] vector: 300ng.
[0034] (4) Carry out PCR, wherein the conditions of PCR are as follows:
[0035] (4.1) One cycle, 95°C for 30 ...
Embodiment 2
[0043] Expression of myristoylated mitochondria-localized polypeptide sequence (myr-mito):
[0044] First, HEK293 cells were seeded in 24-well plates, and then 24 hours later, the GFP fusion plasmid of myristoylated mitochondrial localization sequence (myr-mito) was transfected into HEK293 cells using lipo2000 transfection reagent at a plasmid quantity of 300 ng per well , 24 hours after transfection, the localization was observed by fluorescence microscope (scale bar: 20 μm). It can be seen that the mitochondrial localization sequence with myristoylation in the present invention can be expressed in HEK293 cells, and exhibits mitochondrial localization.
Embodiment 3
[0046] Location of myristoylated mitochondrial targeting polypeptide sequence (myr-mito):
[0047] First, HEK293 cells were seeded in 24-well plates, and then 24 hours later, the GFP fusion plasmid of myristoylated mitochondrial localization sequence (myr-mito) and commercial mitochondria were transfected with lipo2000 transfection reagent at a plasmid quantity of 300 ng per well. The localization plasmid (Mito-RFP) or endoplasmic reticulum localization plasmid (ER-RFP) was transfected into HEK293 cells, and its localization was observed by fluorescence microscope 24 hours after transfection (scale bar: 20 μm). It can be seen that the mitochondrial localization sequence with myristoylation in the present invention can be localized to the mitochondria instead of the endoplasmic reticulum.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com