Supercharge Your Innovation With Domain-Expert AI Agents!

Myristoylated polypeptide for coding mitochondrial localization as well as preparation method and application of myristoylated polypeptide

A technology of myristoylation and mitochondria, which is applied in the field of molecular genetics, can solve the problems that foreign proteins cannot be imported into mitochondria, and achieve the effect of promoting combination

Inactive Publication Date: 2021-08-27
SUZHOU UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing mitochondrial guiding peptides cannot introduce fatty acid-modified foreign proteins into mitochondria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Myristoylated polypeptide for coding mitochondrial localization as well as preparation method and application of myristoylated polypeptide
  • Myristoylated polypeptide for coding mitochondrial localization as well as preparation method and application of myristoylated polypeptide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Sequence screening and confirmation of myristoylated mitochondria-localized peptides:

[0024] (1) The myristoylation conserved sequence is derived from the front sequence of protein MARCKS: MGAQFSK.

[0025] The corresponding nucleotide is: ATGGGTGCCCAGTTCTCCAAG.

[0026] (2) Customize PCR primers for the GluN1 C0 region with myristoylation conserved sequence, the sequence of which is as follows:

[0027] GluN1: 5'-3' (with myristoylation conserved sequence): TCGGCTAGCACCATGGGTGCCCAGTTCTCCAAGATCGCCTACAAGCGACACAAGGATGCC; 3'-5': AGCTGTCGACCTGCAGGTTCTTCCTCCACACGTTCAC.

[0028] (3) The GluN1 plasmid was used as a template for conventional PCR. (The PCR kit was purchased from TaKaRa Co., Ltd.) system. The PCR system (25 μL) is as follows (unit: μL):

[0029] 10×Buffer: 2.5,

[0030] dNTP: 2,

[0031] Taq: 0.5;

[0032] primer: 2;

[0033] vector: 300ng.

[0034] (4) Carry out PCR, wherein the conditions of PCR are as follows:

[0035] (4.1) One cycle, 95°C for 30 ...

Embodiment 2

[0043] Expression of myristoylated mitochondria-localized polypeptide sequence (myr-mito):

[0044] First, HEK293 cells were seeded in 24-well plates, and then 24 hours later, the GFP fusion plasmid of myristoylated mitochondrial localization sequence (myr-mito) was transfected into HEK293 cells using lipo2000 transfection reagent at a plasmid quantity of 300 ng per well , 24 hours after transfection, the localization was observed by fluorescence microscope (scale bar: 20 μm). It can be seen that the mitochondrial localization sequence with myristoylation in the present invention can be expressed in HEK293 cells, and exhibits mitochondrial localization.

Embodiment 3

[0046] Location of myristoylated mitochondrial targeting polypeptide sequence (myr-mito):

[0047] First, HEK293 cells were seeded in 24-well plates, and then 24 hours later, the GFP fusion plasmid of myristoylated mitochondrial localization sequence (myr-mito) and commercial mitochondria were transfected with lipo2000 transfection reagent at a plasmid quantity of 300 ng per well. The localization plasmid (Mito-RFP) or endoplasmic reticulum localization plasmid (ER-RFP) was transfected into HEK293 cells, and its localization was observed by fluorescence microscope 24 hours after transfection (scale bar: 20 μm). It can be seen that the mitochondrial localization sequence with myristoylation in the present invention can be localized to the mitochondria instead of the endoplasmic reticulum.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a myristoylated polypeptide for coding mitochondrial localization as well as a preparation method and application thereof, and belongs to the technical field of molecular genetics. The polypeptide sequence has an amino acid sequence represented by an M-N formula, M is an amino acid sequence represented by SEQ ID No. 1, and N is an amino acid sequence represented by SEQ ID No. 2. The invention also discloses application of the polypeptide, a polypeptide composition, a nucleic acid and a polypeptide conjugate in expression of the myristoylated mitochondrial localization protein. The amino terminal of the sequence provided by the invention has a myristoylated conserved sequence which can be myristoylated and then inserted into a mitochondrial cell membrane.

Description

technical field [0001] The invention relates to the technical field of molecular genetics, in particular to a myristoylated polypeptide encoding mitochondrial location and its preparation method and application. Background technique [0002] The present invention belongs to the field of molecular genetics. Mitochondrial function studies rely on mitochondrial co-localized marker genes and associated fluorescent dyes. However, how to artificially introduce fatty acid-modified target proteins into mitochondria is a difficult point in current research. [0003] Observing and studying mitochondrial function relies on mitochondrial localized marker genes and fluorescent dyes. At the same time, by fusing the target gene with the mitochondrial guide peptide, the target protein encoded by the target gene can be introduced into the mitochondria. These methods make studying mitochondrial function simple and straightforward. [0004] The introduction of fatty acid-modified target pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12Q1/02
CPCC07K14/00C07K14/795C07K14/765C07K14/77G01N33/5079C07K2319/033C07K2319/07
Inventor 周亮
Owner SUZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More