Novel promoter sequences and methods thereof for enhanced protein production in bacillus cells
A Bacillus, promoter technology, applied in chemical instruments and methods, peptides, depsipeptides, etc., can solve problems such as unsatisfactory
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example
[0290] Certain aspects of the invention can be further understood from the following examples, which should not be construed as limiting. Modifications of materials and methods will be readily apparent to those skilled in the art.
example 1
[0292] Construction of aprE Cas9 targeting vector
[0293]A synthetic polynucleotide encoding the Cas9 protein (SEQ ID NO: 1 ) from Streptococcus pyogenes (which comprises an N-terminal nuclear localization sequence (NLS; "APKKKRKV"; SEQ ID NO: 2), a C-terminal NLS ("KKKKLK"; SEQ ID NO:3) and a deca-histidine tag ("HHHHHHHHHH"; SEQ ID NO:4)) were operably linked to the aprE promoter (P-aprE) from Bacillus subtilis (SEQ ID NO:5), and using Q5 DNA polymerase (NEB) (according to the manufacturer's instructions) with the forward (SEQ ID NO:6) and reverse (SEQ ID NO:7) primer pairs listed in Table 1 below Amplify.
[0294] Table 1
[0295] Forward and reverse primer pairs
[0296] Forward ATATATGAGTAAACTTGGTCTGACAGAATTCCTCCATTTTCTTCTGCTAT SEQ ID NO:6 reverse TGCGGCCGCGAATTCGATTACGAATGCCGTCTCCC SEQ ID NO:7
[0297] Plasmid pKB320 (SEQ ID NO: 10) and reverse (SEQ ID NO: 11 ) primer pairs listed in Table 2 below were amplified using Q5 DNA polymerase (NE...
example 2
[0314] Production of Bacillus cells comprising exemplary expression cassettes
[0315] In this example, Applicants introduced a protease expression cassette (eg, an exemplary POI) into Bacillus subtilis cells. More specifically, the expression cassette comprises: (1) a DNA sequence homologous to the upstream (5') flanking region (SEQ ID NO:39) of the yhfN gene, operatively fused to (2a) a gene encoding a native B. subtilis The DNA sequence of the Bacillus rrnIp2 promoter (SEQ ID NO:39) or (2b) its genetically modified rrnIp2 sequence, designated herein as the "rrnIp2-1" promoter (SEQ ID NO:40), said native and A modified promoter DNA sequence (3) operably fused to a DNA sequence encoding a mature (subtilisin) protease (4) operably fused to a DNA sequence encoding a mature (subtilisin) protease (4) to a DNA sequence encoding a Bacillus amyloliquefaciens The DNA sequence of the apr terminator sequence (SEQ ID NO: 41), wherein the promoter is located 5' to the DNA sequence encod...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



