Unlock instant, AI-driven research and patent intelligence for your innovation.

Novel promoter sequences and methods thereof for enhanced protein production in bacillus cells

A Bacillus, promoter technology, applied in chemical instruments and methods, peptides, depsipeptides, etc., can solve problems such as unsatisfactory

Pending Publication Date: 2021-09-07
DANISCO US INC
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] Although many promoters for expressing genes in host cells are well known, there remains a continuing and unmet need in the art for novel promoter (nucleic acid) sequences

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel promoter sequences and methods thereof for enhanced protein production in bacillus cells
  • Novel promoter sequences and methods thereof for enhanced protein production in bacillus cells
  • Novel promoter sequences and methods thereof for enhanced protein production in bacillus cells

Examples

Experimental program
Comparison scheme
Effect test

example

[0290] Certain aspects of the invention can be further understood from the following examples, which should not be construed as limiting. Modifications of materials and methods will be readily apparent to those skilled in the art.

example 1

[0292] Construction of aprE Cas9 targeting vector

[0293]A synthetic polynucleotide encoding the Cas9 protein (SEQ ID NO: 1 ) from Streptococcus pyogenes (which comprises an N-terminal nuclear localization sequence (NLS; "APKKKRKV"; SEQ ID NO: 2), a C-terminal NLS ("KKKKLK"; SEQ ID NO:3) and a deca-histidine tag ("HHHHHHHHHH"; SEQ ID NO:4)) were operably linked to the aprE promoter (P-aprE) from Bacillus subtilis (SEQ ID NO:5), and using Q5 DNA polymerase (NEB) (according to the manufacturer's instructions) with the forward (SEQ ID NO:6) and reverse (SEQ ID NO:7) primer pairs listed in Table 1 below Amplify.

[0294] Table 1

[0295] Forward and reverse primer pairs

[0296] Forward ATATATGAGTAAACTTGGTCTGACAGAATTCCTCCATTTTCTTCTGCTAT SEQ ID NO:6 reverse TGCGGCCGCGAATTCGATTACGAATGCCGTCTCCC SEQ ID NO:7

[0297] Plasmid pKB320 (SEQ ID NO: 10) and reverse (SEQ ID NO: 11 ) primer pairs listed in Table 2 below were amplified using Q5 DNA polymerase (NE...

example 2

[0314] Production of Bacillus cells comprising exemplary expression cassettes

[0315] In this example, Applicants introduced a protease expression cassette (eg, an exemplary POI) into Bacillus subtilis cells. More specifically, the expression cassette comprises: (1) a DNA sequence homologous to the upstream (5') flanking region (SEQ ID NO:39) of the yhfN gene, operatively fused to (2a) a gene encoding a native B. subtilis The DNA sequence of the Bacillus rrnIp2 promoter (SEQ ID NO:39) or (2b) its genetically modified rrnIp2 sequence, designated herein as the "rrnIp2-1" promoter (SEQ ID NO:40), said native and A modified promoter DNA sequence (3) operably fused to a DNA sequence encoding a mature (subtilisin) protease (4) operably fused to a DNA sequence encoding a mature (subtilisin) protease (4) to a DNA sequence encoding a Bacillus amyloliquefaciens The DNA sequence of the apr terminator sequence (SEQ ID NO: 41), wherein the promoter is located 5' to the DNA sequence encod...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present disclosure is generally related to novel promoter sequences and methods thereof for enhanced protein production in Bacillus sp. (host) cells. As set forth herein, the novel promoter sequences of the disclosure, when operably linked to a gene or open reading frame encoding a protein of interest, are particularly well suited for use in large scale production of industrially relevant proteins.

Description

technical field [0001] The present disclosure relates generally to the fields of bacteriology, microbiology, molecular biology, genetics, enzymology, industrial protein production, and the like. More particularly, certain embodiments of the present disclosure relate to novel promoter sequences and methods for their use in obtaining an enhanced protein production phenotype in Bacillus sp. (host) cells. As described herein, when the novel promoter sequences of the present disclosure are operably linked to a gene (or open reading frame) encoding a protein of interest, they are particularly suitable for large-scale production of industrially relevant proteins. [0002] Cross References to Related Applications [0003] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 772,363, filed November 28, 2018, which is hereby incorporated by reference in its entirety. [0004] References to Sequence Listings [0005] The content of the electronic submissio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/75C07K14/32
CPCC12N15/75C07K14/32C12N9/14
Inventor S·I·R·斯塔布斯C·邦焦尔尼R·L·弗里施C·莱夫朗
Owner DANISCO US INC