Method for amplifying and detecting nucleic acid and kit

A technology for targeting nucleic acids and oligonucleotides, which is applied in biochemical equipment and methods, and the determination/inspection of microorganisms.

Pending Publication Date: 2021-10-22
青岛简码基因科技有限公司
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

LAMP technology is well known for its high sensitivity and specificity, but this technology is prone to sample contamination, and the design of primers is difficult, making it impossible to detect highly mutated species targets
However, the reaction system of HDA technology requires two enzymes, and the dual-enzyme system is likely to cause non-specific amplification, which affects the judgment of the experimental results.
These shortcomings limit the popularization and application of these technologies to a certain extent.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for amplifying and detecting nucleic acid and kit
  • Method for amplifying and detecting nucleic acid and kit
  • Method for amplifying and detecting nucleic acid and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0225] 5.2 Example 1: Optimization of primer concentration in the fast strand displacement amplification (SEA) reaction system.

[0226] The following study was performed to test the effect of primer concentration on the amplification rate of the fast SEA reaction.

[0227] Based on the target nucleic acid sequence of the hypervariable region of the 16S rRNA coding gene of Listeria monocytogenes, a pair of specific primers were designed by NUPACK software (www.nupack.org / ). , the target sequence is a 50bp synthetic fragment with the following sequence:

[0228] 5'- GGGTCATTGGAAACTGGAAGACTGGAGTGCAGAAGAGGAGAGTGGAATTC-3' (SEQ ID NO: 1),

[0229] The primer sequences are:

[0230] Primer 1: 5'-GTCATTGGAAACTGGAAGACTG-3' (M58822.1 b) (SEQ ID NO: 2);

[0231] Primer 2:5'-CCACTCTCCTCTTCTGCAC-3'(M58822.1 b)(SEQ ID NO:3).

[0232] Primers and target fragments were chemically synthesized (Sangon Bioengineering Co., Ltd., Shanghai, China). DNA polymerase, dNTPs solution, other buffer...

Embodiment 2

[0238] 5.3 Example 2: Optimization of polymerase concentration for fast strand displacement amplification (SEA) reaction system.

[0239] The following studies were performed to test the effect of polymerase concentration on the rate of fast SEA reactions.

[0240] The same primers (SEQ ID NO: 1 and 2) were designed against the same target sequence in the above L. monocytogenes genome (SEQ ID NO: 1) as described in Example 1 above. Prepare the primers and the L. monocytogenes genome as described above and mix with the other PCR reactions to form a 10 µL amplification mix as shown in Table 2 below. In order to achieve the optimal amplification rate with the polymerase concentration, four amplification mixtures containing different enzyme concentrations were prepared, each containing a final concentration of 3.0×10 -6 M primers and final concentrations of 0.16 U / μL, 0.20 U / μL, 0.24 U / μL, and 0.28 U / μL (corresponding to 8 U / μL enzyme stock solutions of 0.20 μL, 0.25 μL, 0.30 μL,...

Embodiment 6

[0272] 5.7 Example 6: Comparison of isothermal SEA reaction under constant temperature conditions and fast SEA reaction under rapid thermal cycling conditions

[0273] The following study compares the isothermal SEA reaction carried out under constant temperature conditions (such as the procedure described in CN 109136337A) and the fast SEA reaction under the current fast thermal cycle conditions.

[0274] Specifically, the same primers (SEQ ID NO: 1 and 2) were designed for the same L. monocytogenes genome (SEQ ID NO: 1) target sequence according to the method described above. The primers and L. monocytogenes genomic material were obtained according to the method mentioned above, and mixed with other PCR reactions to form a 10 μL amplification mixture, the components of which are shown in Table 5 below. In addition, this study set up a series with different initial concentrations (1.0×10 -11 M, 1.0×10 -12 M, 1.0×10 -13 M, 1.0×10 -14 M, 1.0×10 -15 M, 1.0×10 -16 M, 1.0×10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
volumeaaaaaaaaaa
Login to View More

Abstract

The invention provides a method for denatured bubble mediated target nucleic acid amplification and a related kit and use thereof. According to the method, generation of denatured bubbles in double-stranded target nucleic acid molecules is promoted through rapid temperature-changing thermal circulation, so that the strand displacement amplification (SEA) reaction is accelerated. The kit comprises a specially designed primer and a polymerase for performing the method. The method and kit can be used in various situations, such as diagnosis of infectious or genetic diseases, sample quality control, and single nucleotide polymorphism (SNP) analysis.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an improved method for amplifying target nucleic acid mediated by denatured bubbles, a special kit and application thereof. 1. Background technology [0002] Nucleic acid can be divided into deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), and is the basic element of all life forms. DNA carries genetic information and is responsible for encoding amino acids, the building blocks of proteins. RNA plays an important role in the coding, decoding, regulation and expression of genes. Therefore, nucleic acids have been used as important biomarkers in biological research and medical diagnosis. Nucleic acid amplification technology provides an important theoretical basis for the detection of pathogenic microorganisms, the traceability and authenticity of biological materials (such as meat), and other genetic testing. Establishing a simple, easy-to-operate, sensitive and rapid nuclei...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6844
CPCC12Q1/6844C12Q2531/113C12Q2531/119C12Q2521/107C12Q2521/101
Inventor石超刘蒙蒙李阳马翠萍
Owner青岛简码基因科技有限公司