Unlock instant, AI-driven research and patent intelligence for your innovation.

Absolute fluorescent quantitative PCR primer pair for detecting Lawsonia intracellularis, kit and detection method thereof

A technology of fluorescence quantification and Lawsonia, which is applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc. It can solve the problems of inability to truly reflect the infection of pigs, low sensitivity, and inability to quantify bacteria, etc. problems, to achieve the effect of convenient primer design, avoid cross-contamination, and improve viability

Pending Publication Date: 2021-10-22
NANJING AGRICULTURAL UNIVERSITY
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Conventional polymerase chain reaction (PCR) can use a small amount of samples to obtain accurate and reliable results through the amplification of target genes. It has the advantages of simple operation, low equipment requirements, rapid response and large-scale detection. A common method for the detection of Lawsonia intracellulare in the swine industry, but due to the low sensitivity of this method and the inability to quantify the bacteria in clinical samples, it cannot truly reflect the infection situation of pigs. In view of this, a method was established An accurate, reliable and quantitative detection method for Lawsonia intracellulare in clinical samples is of great significance for the effective prevention and control of PPE

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Absolute fluorescent quantitative PCR primer pair for detecting Lawsonia intracellularis, kit and detection method thereof
  • Absolute fluorescent quantitative PCR primer pair for detecting Lawsonia intracellularis, kit and detection method thereof
  • Absolute fluorescent quantitative PCR primer pair for detecting Lawsonia intracellularis, kit and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] 1. DNA extraction of Lawsonia intracellulare from porcine ileum tissue samples:

[0049] (1) Take about 25mg of porcine ileum samples frozen at -80°C, put them in a 2ml centrifuge tube, and cut them into pieces as much as possible with scissors

[0050] (2) Add 180 μL of Buffer LS-2, 20 μL of Proteinase K and 10 μL of RNase A (10 mg / ml), and warm in a 56°C water bath until the tissue is completely lysed. (It takes about 2 to 3 hours, and the sample can be taken out from time to time for shaking or pipetting to speed up the lysis)

[0051] (3) Centrifuge at 12000rpm for 2 minutes to remove impurities.

[0052] (4) Add 200 μL Buffer BS-2 and 200 μL 100% ethanol to the lysate, and mix well by pipetting.

[0053] (5) Transfer the above solution to a Universal DNA Mini Column, let stand at room temperature for 1 min, centrifuge at 12000 rpm for 1 min at room temperature, and discard the filtrate.

[0054] (6) Add 500 μL of Buffer WA to the Mini Column, centrifuge at 12,00...

Embodiment 2

[0077] Example 2 The primary detection application of the absolute fluorescence quantitative PCR detection method in clinical samples.

[0078] The 178 suspected PPE samples collected clinically were detected by IFA and absolute fluorescent quantitative PCR. The results (Table 2) showed that 93 positive samples were detected by IFA in 178 diseased materials, and 93 positive samples were detected by IFA in 3 different regional slaughterhouses. The rates were 54.2%, 57.9% and 42.9% respectively; while 99 positive samples were detected by the qPCR method, the positive detection rates in the slaughterhouse were 56.9%, 61.4% and 47% respectively, indicating that the established detection method can be used in clinical applications .

[0079] Table 2

[0080]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an absolute fluorescent quantitative PCR primer pair for detecting Lawsonia intracellularis, a kit and a detection method thereof, the primer pair comprises an upstream primer and a downstream primer, and the nucleotide sequence of the upstream primer is shown as follows: the upstream primer is GCTGTGGATTGGGAGAAATC (SEQ ID NO.1); and the downstream primer is CAAGTTGACCAGCCTCTGC (SEQ ID NO. 2). The invention also establishes an absolute fluorescent quantitative PCR detection method for Lawsonia intracellularis, and the method comprises the step of carrying out fluorescent quantitative PCR detection by utilizing the primer pair. Compared with the traditional method, the real-time fluorescent quantitative PCR based on the nucleic acid specific sequence molecular method has the advantages of rapidness, sensitivity, specificity and stability. The kit can be used for rapid and specific detection of low-content Lawsonia intracellularis in a clinical sample, and the content of Lawsonia intracellularis can be detected through a quantitative method, so that a foundation is laid for understanding the change rule of Lawsonia intracellularis in a pig body, diagnosis of porcine proliferative ileitis, epidemiological investigation and research on the pathogenic mechanism of Lawsonia intracellularis.

Description

technical field [0001] The invention belongs to the technical field of Lawsonia intracellulare detection, and in particular relates to an absolute fluorescence quantitative PCR primer pair, a kit and a detection method for detecting Lawsonia intracellulare. Background technique [0002] Porcine ileitis, also known as porcine proliferative enteritis (PPE), is a contact intestinal infectious disease caused by Lawsonia intracellularis (L.intracellularis), which mainly affects the growth of pigs. Speed, bring serious economic losses to pig industry, has become a kind of important enteric disease in modern pig industry. The incidence rate of PPE in Europe and the United States can reach 50%-70%. In South Korea, Thailand, Malaysia and other countries, the positive rate of PPE is 100%. The loss caused by PPE in the US pig industry alone is not less than 2000 million U.S. dollars, and the UK loses about 4 million pounds a year due to PPE. In Europe, due to the prohibition of the u...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6851C12Q1/06C12N15/11
CPCC12Q1/689C12Q1/6851C12Q2531/113C12Q2545/114C12Q2563/107
Inventor 范红结胡雨婷李剑男肖宁周红蔺辉星
Owner NANJING AGRICULTURAL UNIVERSITY