Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Hepatitis b immunisation regimen and compositions

A technology for hepatitis B, chronic hepatitis B, applied to a method and compositions used in such schemes and methods, field of immunization schemes for treating chronic hepatitis B

Pending Publication Date: 2021-10-29
GLAXOSMITHKLINE BIOLOGICALS SA +1
View PDF32 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There remains an unmet need for treatments that can halt the progression or reversal of HDV-induced chronic hepatitis, and / or can clear chronic HDV infection (chronic hepatitis D-CHD) or HBV / HDV co-infection (CHB / CHD)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hepatitis b immunisation regimen and compositions
  • Hepatitis b immunisation regimen and compositions
  • Hepatitis b immunisation regimen and compositions

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0421] Example 1: Antisense suppression of HBV virus mRNA in HepG2.2.15 cells by MOE spacers

[0422] HepG2.2.15 cells are a widely used cell model for studying hepatitis B virus in vitro. In these cells, the HBV genome integrates into several sites in the cellular DNA. Cells were originally derived from the human hepatoblastoma cell line HepG2 and are characterized by stable HBV expression and replication in culture systems.

[0423] Antisense oligonucleotides were designed to target HBV viral nucleic acids and their effects on HBV mRNA were tested in vitro. Cultured HepG2.2.15 cells were transfected at a density of 25,000 cells per well using 15,000 nM antisense oligonucleotide electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. The viral primer probe set RTS3370 (forward sequence CTTGGTCATGGGCCATCAG, designated herein as SEQ ID NO: 17; reverse sequence CGGCTA...

Embodiment 2

[0435] Example 2: Tolerance of MOE spacers targeting HBV in BALB / c mice

[0436] BALB / c mice (Charles RiVer, MA) are a versatile model of mice frequently used for safety and efficacy testing. Mice were treated with antisense oligonucleotides selected from Example 1 above, and changes in the levels of various metabolic markers were assessed.

[0437] Each group of four BALB / c mice was subcutaneously injected with 50mg / kg of all the sequence numbers of WO2012 / 145697 SEQ ID NO: 83, SEQ ID NO: 224, SEQ ID NO: 88, SEQ ID NO: 103, SEQ ID NO: 20 , SEQ ID NO: 116, SEQ ID NO: 187, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 226, SEQ ID NO: 24, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 50, SEQ ID NO: 140, SEQ ID NO: 17, SEQ ID NO: 27, SEQ ID NO: 40 and SEQ ID NO: 74, twice a week for 3 weeks. A group of four BALB / c mice were subcutaneously injected with 50 mg / kg of an antisense oligonucleotide having the sequence CCTTCCCTGAAGGTTCCTCC (SEQ ID NO of WO2012 / 145697: 320), a 5-10-5 MOE spac...

Embodiment 3

[0454] Example 3: Effectiveness of MOE spacers targeting HBV in transgenic mice

[0455] Mice carrying HBV gene fragments were used (Guidotti, L.G et al. J. Virol. 1995, 69, 6158-6169). Mice were treated with antisense oligonucleotides selected from the studies described above and their response in this model was assessed.

[0456] Each group of 6 mice was subcutaneously injected with 50 mg / kg of SEQ ID NO: 83, SEQ ID NO: 226, SEQ ID NO: 224, SEQ ID NO: 181, SEQ ID NO: 143 or SEQ ID NO: 145 (WO2012 / 145697) twice a week for 4 weeks. A control group of 10 mice were injected subcutaneously with PBS twice a week for 4 weeks. Mice were euthanized 48 hours after the last dose, and livers were collected for further analysis.

[0457] DNA and RNA analysis

[0458] Using the primer probe set RTS3370, RNA was extracted from liver tissue for real-time PCR analysis of HBV DNA. DNA levels were normalized to picogreen. After RT-PCR analysis, HBV RNA samples were also assayed with pri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

There is provided a method of treating chronic hepatitis B infection (CHB) and / or chronic hepatitis D infection (CHD) in a human, comprising the steps of: a) administering to the human a composition comprising an antisense oligonucleotide (ASO) 10 to 30 nucleosides in length, targeted to a HBV nucleic acid (an HBV ASO); b) administering to the human a composition comprising a replication-defective chimpanzee adenoviral (ChAd) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc); c) administering to the human a composition comprising a Modified Vaccinia Virus Ankara (MVA) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc); and d) administering to the human a composition comprising a recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and an adjuvant.

Description

[0001] field of invention [0002] The present invention relates to immunization regimens, methods for treating chronic hepatitis B, and compositions useful in such regimens and methods, particularly suitable for use in the treatment of chronic hepatitis B. The protocols and methods involve administering compositions comprising antisense oligonucleotides, compositions comprising vehicles for delivery of hepatitis B antigen, and compositions comprising recombinant hepatitis B antigen protein. Background technique [0003] Hepatitis B virus is a DNA virus with a partially double-stranded circular DNA genome. The full-length chain is 3020-3320 nucleotides in length and the shorter chain is 1700-2800 nucleotides in length. Viral DNA can be found in the nucleus shortly after cell infection. After infection, cellular DNA polymerase fully double-stranded the viral genome and ligated the ends. The viral core (C), surface (S) and X genes each overlap with the viral polymerase (P) gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/12
CPCA61K39/12A61K2039/53A61K2039/545A61K2039/55572A61K2039/55577C12N2730/10134A61K39/292C12N15/86
Inventor B.巴亚特R.K.哈马塔克C.M.M.洛林V.B.拉西列夫L.E-R.沃特S.K.尤
Owner GLAXOSMITHKLINE BIOLOGICALS SA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com