Check patentability & draft patents in minutes with Patsnap Eureka AI!

Molecular marker Lnc-HEATR1-4 for diagnosis and prognosis of acute myeloid leukemia and application of molecular marker Lnc-HEATR1-4

A leukemia, acute myeloid technology, applied in the field of biomedicine, can solve the problem that the function of lncRNA has not been elucidated

Pending Publication Date: 2021-11-02
广州齐凯生物科技有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in AML, there are still a large number of lncRNAs whose functions have not been elucidated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker Lnc-HEATR1-4 for diagnosis and prognosis of acute myeloid leukemia and application of molecular marker Lnc-HEATR1-4
  • Molecular marker Lnc-HEATR1-4 for diagnosis and prognosis of acute myeloid leukemia and application of molecular marker Lnc-HEATR1-4
  • Molecular marker Lnc-HEATR1-4 for diagnosis and prognosis of acute myeloid leukemia and application of molecular marker Lnc-HEATR1-4

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1 Identification means and data analysis method of Lnc-HEATR1-4

[0050] Study cohort:

[0051] The inventor downloaded the transcriptome sequencing data sets and corresponding clinical information of 151 AML patients from the TCGA (https: / / www.cancer.gov / ) database, and the expression profiles of the normal control population were downloaded from the GTEx database. Fifteen patients with M3 type were excluded, and a total of 136 AML patients with complete Lnc-HEATR1-4 expression profile were included in the follow-up analysis, wherein the nucleotide sequence of Lnc-HEATR1-4 is shown in SEQ ID NO:1:

[0052] TGCATACCTCATGGCCAGGATATCTGCAATAGCTGCAAACCACTATGAGTTCTTTGG AAAGAGACACAAGAAGGTTCGAGGCCACACTAGGCCCAAAGCCAATGCTGACGGAGACAATGACAAGCACTCACTGCCTCTGAAGGAAACTCCACGTTAAGCCACGCCCCCACACCTGGGATTCCAGGGCCTGCTCTTCTCTGCTGGACTCCCAGACTGCAACCCAGACTGCACTGTTAGAAACCAGAGAACTGCATGATCATGAGGATGAGTGGGTGCCTGTGGGTCTTCAAGACATGGCATCCACCTGCCGTGGACCAGTCCAGTCTGCAGGCGTGGACTCTGACAGCTGGCTCCACCCAG...

Embodiment 2

[0058] Example 2 Comparison of clinical and molecular characteristics between the Lnc-HEATR1-4 high expression group and the Lnc-HEATR1-4 low expression group

[0059] According to the median expression of Lnc-HEATR1-4 in AML patients, 136 patients were divided into Lnc-HEATR1-4 high expression group and Lnc-HEATR1-4 low expression group, each group contained 68 patients, their clinical features and molecular The characteristics are shown in Table 1. As shown in Table 1, comparing the clinical and molecular characteristics of the two groups of patients showed that in terms of age characteristics, in the group of patients 60 years old Among them, the expression of Lnc-HEATR1-4 was mainly low (p=0.039). However, in the population with complex cytogenetic characteristics, Lnc-HEATR1-4 was mainly highly expressed (p=0.023). In addition, the RUNX1-RUNX1T1 gene fusion tended to occur in the Lnc-HEATR1-4 low expression group (p=0.02). The mutation frequency of KRAS gene was also s...

Embodiment 3

[0064] Example 3 Lnc-HEATR1-4 is significantly highly expressed in AML

[0065] In order to analyze the expression of Lnc-HEATR1-4 in AML, this embodiment analyzes the expression level of Lnc-HEATR1-4 in 151 cases of AML patients and 70 cases of normal people, the results show that the expression of Lnc-HEATR1-4 in AML The expression was significantly higher than that of the normal population ( figure 1 A, p<2.22e-16), indicating that Lnc-HEATR1-4 can be used for the diagnosis or auxiliary diagnosis of acute myeloid leukemia.

[0066] AML patients were further classified according to the ELN classification system, and were divided into three groups: good prognosis group, intermediate prognosis group and poor prognosis group. The Lnc-HEATR1-4 expression levels of the three groups were analyzed respectively, and the results showed that there was no significant difference in the Lnc-HEATR1-4 expression levels among the three groups ( figure 1 B, p=0.068).

[0067] The AML pati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker Lnc-HEATR1-4 for diagnosis and prognosis of acute myeloid leukemia and the application of the molecular marker Lnc-HEATR1-4. A nucleotide sequence of the molecular marker Lnc-HEATR1-4 is shown as SEQ ID NO: 1. The expression level of the Lnc-HEATR1-4 can be used as an independent factor for predicting the prognosis effect of the acute myelogenous leukemia, and the prognosis significance of the Lnc-HEATR1-4 in the acute myelogenous leukemia is still effective for patients who only receive chemotherapy. Moreover, the expression quantity of the Lnc-HEATR1-4 in patients with acute myelogenous leukemia is obviously increased compared with normal people, which indicates that the Lnc-HEATR1-4 can be used for diagnosis or auxiliary diagnosis of acute myelogenous leukemia. The invention provides a new thought for diagnosis and treatment of acute myelogenous leukemia. The Lnc-HEATR1-4 gene recognized by the invention can be used as an effective index for predicting diagnosis and prognosis effects of patients with acute myelogenous leukemia in the future.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to an acute myeloid leukemia diagnosis and prognosis molecular marker Lnc-HEATR1-4 and application thereof. Background technique [0002] Acute myeloid leukemia (AML) is a lethal hematologic malignancy characterized by poor prognosis and high mortality. The current treatment methods for AML are mainly chemotherapy and bone marrow transplantation. With the development of targeted therapy, many gene mutations in AML have been used as molecular markers to predict its prognosis. In recent years, a large number of studies have shown that long non-coding RNA not only participates in various biological processes of normal cells, but also plays an important role in tumor cells. For example, the aberrant activation of lncRNA HOTTIP in AML can alter HOXA-driven topology-associated domains and gene expression, thereby affecting tumorigenesis and development. In addition, lncRNA KCNQ1O...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12N15/11C12N15/113A61K45/00A61P35/02
CPCC12Q1/6886A61K45/00A61P35/02C12Q2600/118C12Q2600/136C12Q2600/158C12Q2600/178
Inventor 曾添晟赖国锋陆家雯梁美冯雪
Owner 广州齐凯生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com