Co-segregated kasp molecular marker of wheat spotted leaf gene lm5 and its application
A technology of molecular markers and co-separation, applied in the field of molecular genetics, can solve the problems of insufficient molecular markers, achieve accurate and efficient detection, improve resistance to stripe rust and powdery mildew, and facilitate and stabilize amplification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1 The acquisition of the wheat spotted leaf gene Lm5 and its molecular marker KASP-sicau11
[0038] (1) Using the spotted leaf mutant material MC21 to cross the wheat line 3642 as the male parent, the hybrid F 1 , F 1 F 2 , to obtain F containing 313 plants 2:3 Families, constituting genetic mapping populations.
[0039] (2)F 2:3 Identification of spotted leaf phenotypes in family groups: the leaf color of each line was analyzed and identified at the jointing stage of wheat, the leaves of the entire row of plants were all green and marked as "A", and the leaves of the entire row of plants with all spotted leaves were marked as "B", and the leaves of the entire row of plants with both spots and green are recorded as "H". Each line was judged one by one, and the judgment result was recorded as the phenotypic marker data of the spotted leaf gene Lm5. In this way, the position located on the linkage map is the position of the Lm5 gene.
[0040] (3) BSR-Seq an...
Embodiment 2
[0061] Example 2 Application of Molecular Marker KASP-sicau11 in Selection and Control of Speckled Leaf Gene Lm5
[0062] (1) Using the wheat mutant material MC21 with speckled leaves as the female parent and the common wheat variety CN16 with normal leaves as the male parent to construct F 3 In the generation population, 100 lines were randomly mixed among the offspring lines, and each line contained 10 individual plants.
[0063] (2) Carry out KASP-sicau11 marker detection on the obtained 100 strains, the specific method is: extract the DNA of 100 strains by CTAB method at the seedling stage; Specific primer pairs are primers for fluorescent quantitative PCR amplification, and the primers are:
[0064] Primers on the FAM tag: (the underlined part is the FAM tag sequence) 5'- GAAGGTGACCAAGTTCATGCT TCGCAGTTAAAGCGTCAGC-3' (SEQ ID No. 31);
[0065] Primers on the HEX tag: (the wavy part is the HEX tag sequence) 5'- GAAGGTCGGAGTCAACGGATT TCGCAGTTAAAGCGTCAGT-3' (SEQ ID No. 3...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap