Kasp-flw-sau6198 Molecular Marker Linked to the Major QTL of Wheat Flag Leaf Width and Its Application
A kasp-flw-sau6198, molecular marker technology, applied in the fields of molecular biology and crop genetics and breeding, can solve the problem of not many molecular markers, and achieve the effects of accurate and efficient detection, convenient and stable amplification, and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1 Acquisition of the wheat flag leaf width QTL QFLW.sau-AM-4B.4 and its molecular marker KASP-Flw-sau6198
[0043] (1) Using the wheat line 'Ailanmai' as the female parent, and crossing the wheat variety 'LM001' as the male parent, the hybrid F was obtained. 1 , F 1 Generation of individual plants to obtain F by selfing 2 , in F 2 Use the single spike method, all the way to F 8 For generations, a recombinant inbred line containing 121 lines was obtained, which constituted a genetic mapping population.
[0044] (2) Identification of the flag leaf width phenotype of the recombinant inbred line population: The flag leaf width of the recombinant inbred line was analyzed and identified at the maturity stage of wheat. Flag leaf width, and obtain the average value, representing the flag leaf width of the line.
[0045] (3) 55K SNP chip analysis
[0046] a) DNA extraction: DNA was extracted from the parental 'Ailanmai', 'LM001' and the recombinant inbred line popu...
Embodiment 2
[0058] Example 2 Application of molecular marker KASP-Flw-sau6198 in selection and control of flag leaf width QTL QFLW.sau-AM-4B.4
[0059] (1) Recombinant inbred lines were constructed using the tetraploid wheat 'PI 503554' with narrower flag leaves as the male parent and the tetraploid endemic wheat 'Ailanmai' with wider flag leaves as the female parent, and randomly selected from the progeny lines 54 strains.
[0060] (2) Carry out KASP-Flw-sau6198 labeling detection on the obtained 54 strains. The specific method is as follows: extracting the DNA of 54 strains; using it as a template, molecularly marking the specific primer pair of KASP-Flw-sau6198 PCR amplification and fluorescence readings were performed for primers that were:
[0061] Primer on FAM tag: (the underlined part is the FAM tag sequence) 5'- GAAGGTGACCAAGTTCATGCT TCGACAGCCGGACTTCTCGA-3' (SEQ ID No. 1)
[0062] Primer on the HEX tag: (the wavy line part is the HEX tag sequence) 5'-
[0063]
[0064] Un...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


