Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer pair for identifying eggplant dominant parthenocarpy gene by using InDel molecular marker and application of primer pair

A parthenocarpic and molecular marker technology, applied in the field of molecular biology, can solve the problems of long breeding cycle of parthenocarpic inbred lines and new varieties, great influence of environmental conditions, inaccurate selection, etc. The effect of few limiting factors and high selection efficiency

Pending Publication Date: 2022-02-01
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, parthenocarpic inbred lines in eggplant are mainly identified by manually removing the stigma during the flowering period and observing the fruit setting during the fruit setting period. This method is greatly affected by environmental conditions and is time-consuming and labor-intensive. The breeding cycle of inbred lines and new varieties is longer
The Eggplant Genetics and Breeding Research Group of the Chinese Academy of Agricultural Sciences Institute of Vegetables and Flowers has bred the dominant parthenocarpic eggplant inbred line D-10. After years of research, this parthenocarpy resource has been used for the breeding of new eggplant hybrid varieties In the process of utilization, there are problems such as low selection efficiency, selection of parthenocarpy traits affected by the environment, resulting in inaccurate selection, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pair for identifying eggplant dominant parthenocarpy gene by using InDel molecular marker and application of primer pair
  • Primer pair for identifying eggplant dominant parthenocarpy gene by using InDel molecular marker and application of primer pair
  • Primer pair for identifying eggplant dominant parthenocarpy gene by using InDel molecular marker and application of primer pair

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] This embodiment screens the InDel molecular marker linked to the eggplant dominant parthenocarpy gene, and utilizes the InDel molecular marker to identify the eggplant dominant parthenocarpy gene, including the following steps:

[0063] (1) identify parthenocarpy of eggplant plant:

[0064] The test materials are eggplant dominant parthenocarpic inbred line D-10 and non-parthenocarpic inbred line 03-2 independently selected and bred by the eggplant genetics and breeding research group of the Institute of Vegetable and Flower Research, Chinese Academy of Agricultural Sciences, and constructed using them as parents. the F 1 and F 1 F obtained by selfing 2 Segregate groups where 2020 F 2 Population contains 284 individual plants, 2021 F 2 The population contained 392 individual plants. The field trials in 2020 and 2021 were all carried out at the Langfang Experimental Farm of the Vegetable and Flower Research Institute of the Chinese Academy of Agricultural Sciences. ...

Embodiment 2

[0093] This example verifies the accuracy of the InDel molecular markers screened in Example 1 in assisted selection of parthenocarpic strains, the steps are as follows:

[0094] The molecular markers for identifying dominant parthenocarpy characteristics obtained in Example 1 were verified by using 92 eggplant materials with different genetic backgrounds. Among the 92 materials, 51 were dominant parthenocarpy materials created by the dominant parthenocarpy line D-10 and different eggplant inbred lines, and 41 were non-parthenocarpic materials. The field phenotype and molecular marker typing results of the test materials were analyzed by PCR amplification. The amplification system and procedure were the same as those in Example 1.

[0095] The results showed that among the 92 materials, the phenotypic data reflected by the molecular markers were inconsistent with the field investigation results in 4 materials, and the accuracy rate was 95.65%.

Embodiment 3

[0097] This embodiment provides a kit for identifying dominant parthenocarpy gene in eggplant, said kit for identifying dominant parthenocarpy gene in eggplant includes a primer pair and a buffer for identifying dominant parthenocarpy gene in eggplant using InDel molecular markers , DNA polymerase, dNTPs, Mg 2+ , Standard Positive Template and Water.

[0098] The nucleotide sequences of the primer pair for identifying eggplant dominant parthenocarpy gene using InDel molecular markers are shown in SEQ ID No.1-2.

[0099] SEQ ID No. 1: GACTACCACTACAATTGTCAT;

[0100] SEQ ID No. 2: TCCAAGCACAACCTCAAGT.

[0101] The buffer, DNA polymerase, dNTPs and Mg 2+ form a mixture;

[0102] The standard positive template is the genomic DNA solution of eggplant dominant parthenocarpic inbred line D-10 with a concentration of 30 ng / μL.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer pair for identifying an eggplant dominant parthenocarpy gene by using an InDel molecular marker and an application of the primer pair. The primer pair for identifying the eggplant dominant parthenocarpy gene by using the InDel molecular marker comprises nucleotide sequences as shown in SEQ ID No.1-2. The invention further provides the InDel molecular marker linked with the eggplant dominant parthenocarpy gene, a kit for identifying the eggplant dominant parthenocarpy gene and a method for identifying the eggplant dominant parthenocarpy gene. The InDel molecular marker and the corresponding primer pair can be used as auxiliary selection in the breeding process of the eggplant dominant parthenocarpy gene, the screening efficiency is high, the primer pair is not limited by the growth cycle of eggplant, the applicability is high, the breeding efficiency of the eggplant dominant parthenocarpy line is improved, and the breeding cycle is greatly shortened.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a pair of primers for identifying eggplant dominant parthenocarpy genes by using InDel molecular markers and an application thereof. Background technique [0002] Parthenocarpy is an important agronomic trait of eggplant. Eggplant varieties with parthenocarpy characteristics can avoid flower and fruit drop caused by low temperature, thereby ensuring stable yield; meanwhile, parthenocarpic eggplant varieties can produce seedless fruits, prolonging the fruit life after cutting. Browning time, significantly improve the quality of the fruit. Therefore, cultivating new eggplant varieties with parthenocarpic characteristics has a good market prospect. [0003] The natural parthenocarpy materials of eggplant reported at home and abroad are mainly temperature-sensitive, showing parthenocarpy at low temperature (Tian Shibing et al., Preliminary Report on Observation...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/6895
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 刘富中舒金帅张映李淑培陈钰辉杨锦坤
Owner INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI