Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting nucleic acid marker RNA virus based on CRISPR/Cas12a system innovative activation mode

A technology of RNA virus and activation method, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as low RNA content, complex operation process, and cumbersome operation process.

Pending Publication Date: 2022-04-12
TIANJIN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Traditional RNA detection methods generally use different amplification methods due to the characteristics of low RNA content and easy degradation, such as polymerase chain reaction (PCR), loop-mediated isothermal amplification reaction (LAMP), etc., which require complex operating procedures; Some also need to reverse transcribe RNA into DNA, these operations are quite cumbersome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting nucleic acid marker RNA virus based on CRISPR/Cas12a system innovative activation mode
  • Method for detecting nucleic acid marker RNA virus based on CRISPR/Cas12a system innovative activation mode
  • Method for detecting nucleic acid marker RNA virus based on CRISPR/Cas12a system innovative activation mode

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0035] The present invention will be further described in the following examples, but the present invention is not limited thereto.

[0036] Concrete steps of the present invention are as follows:

[0037] (1) Design crRNA and paired DNA

[0038] Design primers on the official website of Integrated DNA Technologies (IDT) in the United States:

[0039] Cr RNA: 5'UAAUUUCUACUAAGUGUAGAUCGUCGCCGUC3'

[0040] Paired DNA: 5'TCAACATCAGTCTGATAAGCTAGACGGCGACG3'

[0041] miRNA-21: 5'UAGCUUAUCAGACUGAUGUUGA3'.

[0042] (2) Construction of CRISPR / Cas12a system

[0043] Add cas12a enzyme and 1x NEB 2.1 reaction buffer, double distilled water, 1nM paired DNA, molecular beacon FQ and designed crRNA (or designed paired DNA) into a 100 μl EP tube.

[0044] (3) Add 1 μM target miRNA-21

[0045] Add target RNA to detect fluorescence changes in real-time fluorescent quantitative PCR.

[0046] (4) Experiment optimization and data processing

[0047] The design of crRNA, the design of paired ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting a nucleic acid marker RNA virus based on a CRISPR / Cas12a system innovative activation mode. The method comprises the following steps: firstly, activating the activity of an enzyme in a new CRISPR / Cas12a system activation mode, and activating the system when a target DNA or RNA is combined with crRNA of the CRISPR / Cas12a system and DNA paired with the crRNA, so as to remove the DNA of an unselected hydrolyzed single-chain beacon molecule; regardless of efficient, rapid, high-sensitivity and strong-specificity detection of DNA and RNA, the method has good specificity, sensitivity and anti-interference capability, provides a new direction for establishing a sensitive and specific nucleic acid marker and RNA virus detection method for serious diseases, does not need complex steps such as reverse transcription when RNA is detected, and is convenient to operate. The specific detection of a target object can be realized only by designing the fixed DNA of the CRISPR / Cas12a system.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for detecting nucleic acid marker RNA viruses based on an innovative activation mode of the CRISPR / Cas12a system. Background technique [0002] A general, accurate, and sensitive nucleic acid detection method can assist pathogen detection, genotyping, and disease monitoring at the point of care, and is of great value in clinical diagnosis. Recently, the CRISPR-Cas system has attracted extensive attention in the field of nucleic acid diagnostics because of the discovery of class II type V and type VI Cas proteins, including the side-cutting activities of Cas13a, Cas12a, Cas12b, and Cas14. Among them, the CRISPR / Cas12a system can hydrolyze single-stranded DNA indiscriminately. [0003] RNA is a marker of many diseases. A common miRNA is a single-stranded RNA molecule with a nucleotide sequence length between 19 and 24 nt. (pre-miRNA) generation, 20% of miRNAs hav...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6813C12Q1/6886C12Q1/70
Inventor 宫晓群韩厚玉周殿明崔警予
Owner TIANJIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com