Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Trichoderma harzianum and application thereof in degradation of waste branches in orchard

A branch and fruit tree technology, applied to Trichoderma harzianum and its application in degrading waste branches in orchards, can solve the problems of slow operation time and low cellulose utilization rate, and achieve improved vitality, accelerated degradation, and high degradation efficiency Effect

Pending Publication Date: 2022-04-29
SHANDONG AGRICULTURAL UNIVERSITY
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Before microorganisms can utilize cellulose, it must be released from lignin and hemicellulose packages, resulting in low cellulose utilization and slow hands-on times

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trichoderma harzianum and application thereof in degradation of waste branches in orchard
  • Trichoderma harzianum and application thereof in degradation of waste branches in orchard
  • Trichoderma harzianum and application thereof in degradation of waste branches in orchard

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] Isolation, identification, preservation of the strain of embodiment 1

[0086] 1. Separation

[0087] A fungus was isolated from the pear tree trunks collected from the fungal base of the South Campus of Shandong Agricultural University, named SDAU-H.

[0088] 2. Identification

[0089] 1. Morphological identification

[0090] The colony of strain SDAU-H was fluffy and white in the early stage of growth, and the color changed from light green to dark green as the mycelium matured. The spores were dark green spherical, and the sporulation was large.

[0091] 2. Molecular biological identification

[0092] SDAU-H was subjected to ITS sequencing, and SDAU-H was identified as Trichoderma harzianum, and the ITS sequence (SEQ ID NO: 1) was as follows:

[0093] TGGGGCTTCACTCCCAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTTTTGTATACCCCCTCGCGGGTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATC...

Embodiment 2

[0097] 1. Test method

[0098] 1.1 Determination of lignocellulose degradation ability

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses trichoderma harzianum and application thereof in degradation of waste branches in orchards, and relates to the technical field of microorganisms. The Trichoderma harzianum SDAU-H disclosed by the invention is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No.23810, the preservation date is November 17, 2021, and the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The trichoderma harzianum provided by the invention has the capability of degrading lignin and cellulose, can improve the activity of degrading enzymes in waste stacks, can play a degradation role to promote the increase of the nitrate nitrogen content in the stacks, and can improve the degradation efficiency of waste branches in orchards.

Description

technical field [0001] The invention relates to the technical field of microorganisms, in particular to a strain of Trichoderma harzianum and its application in degrading waste branches in orchards. Background technique [0002] The orchard produces a large amount of waste such as litter and leaves every year. Due to unreasonable treatment, the discarded fruit tree branches are directly discarded in the garden or simply burned, which not only affects the appearance of the orchard and wastes resources, but also provides a habitat for orchard pests. It becomes a source of infection for orchard diseases and pests, and burning branches also directly causes harm to the environment. [0003] The refractory part of orchard waste is mainly the discarded branches of the orchard, and the main component of the branches is lignocellulose. Under natural conditions, due to its special physical structure and chemical composition, lignocellulose is water-insoluble and biologically resistan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/14C05F15/00C05F11/08C05F17/20C05F17/50C12R1/885
CPCC12N1/14C05F3/00C05F11/08C05F17/20C05F17/50C05F5/002C05F11/00Y02W30/40
Inventor 刘会香张庆霞于成明郝丽琴卢安娜邹玉陈荣靳纪洋
Owner SHANDONG AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com