Trichoderma harzianum and application thereof in degradation of waste branches in orchard
A branch and fruit tree technology, applied to Trichoderma harzianum and its application in degrading waste branches in orchards, can solve the problems of slow operation time and low cellulose utilization rate, and achieve improved vitality, accelerated degradation, and high degradation efficiency Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0085] Isolation, identification, preservation of the strain of embodiment 1
[0086] 1. Separation
[0087] A fungus was isolated from the pear tree trunks collected from the fungal base of the South Campus of Shandong Agricultural University, named SDAU-H.
[0088] 2. Identification
[0089] 1. Morphological identification
[0090] The colony of strain SDAU-H was fluffy and white in the early stage of growth, and the color changed from light green to dark green as the mycelium matured. The spores were dark green spherical, and the sporulation was large.
[0091] 2. Molecular biological identification
[0092] SDAU-H was subjected to ITS sequencing, and SDAU-H was identified as Trichoderma harzianum, and the ITS sequence (SEQ ID NO: 1) was as follows:
[0093] TGGGGCTTCACTCCCAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTTTTGTATACCCCCTCGCGGGTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATC...
Embodiment 2
[0097] 1. Test method
[0098] 1.1 Determination of lignocellulose degradation ability
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com