Klebsiella pneumoniae bacteriophage lyase as well as preparation method and application thereof

A technology of Klebsiella phage and lyase, which is applied in the field of bioengineering, can solve problems such as hindering the contact between lyase and peptidoglycan, and achieve the effect of simple preparation method

Pending Publication Date: 2022-07-29
SOUTHWEST UNIV
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main reason is that the outer membrane wrapped around the peptidoglycan layer of the cell wall of Gram-negative bacteria hinders the contact between the lytic enzyme and the peptidoglycan

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Klebsiella pneumoniae bacteriophage lyase as well as preparation method and application thereof
  • Klebsiella pneumoniae bacteriophage lyase as well as preparation method and application thereof
  • Klebsiella pneumoniae bacteriophage lyase as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Preparation of lyase recombinant protein

[0036] 1. PCR amplification of lyase encoding gene and prokaryotic expression vector gene

[0037] The PCR amplification of the lyase-encoding gene (nucleotide sequence shown in SEQ ID No. 2), using Klebsiella pneumoniae phage DP genomic DNA as a template, the primer sequence used is: forward primer: aacagattggaggaagcttgaaacttacgctggaacaactcaacaaa (SEQ ID No. .3); Reverse primer: cttgctcaccatagaggttagaacagattttgcctttttgtagtatg (SEQ ID No. 4).

[0038] The PCR amplification of the prokaryotic expression vector gene is based on the prokaryotic expression vector pIISA (which contains the His tag sequence for nickel column purification, the zSUMO tag sequence for improving the stability of the target protein, and the eGFP tag sequence for protein tracking) as Template, the primer sequences used are: forward primer: aaatctgttctaacctctatggtgagcaagggcgagg (SEQ ID No. 5); reverse primer: cgtaagtttcaagcttcctccaatctgttcctgatac...

Embodiment 2

[0048] Example 2 Determination of in vitro antibacterial activity of lyase recombinant protein

[0049] In this example, two typical Gram-negative bacteria, Pseudomonas aeruginosa and Escherichia coli, were selected to verify the bacteriostatic activity of the lyase.

[0050] Escherichia coli in logarithmic growth phase were collected by centrifugation and washed twice with PBS, then resuspended with PBS and adjusted the absorbance OD 600 About 1.0; Recombinant proteins His-zSUMO-Endolysin-eGFP and Endolysin-eGFP with a final concentration of 100 μg / mL were added to each group of bacterial solutions, and His-zSUMO-eGFP was used as the control protein; cultured at 37°C, and then every 30min Measure OD 600 Numeric, plots a curve over time. At the same time, in order to investigate the effect of external membrane penetrant on the bacteriostatic activity of lyase, Triton X-100 (outer membrane penetrant) with a final concentration of 1% was also added to the bacterial solution fo...

Embodiment 3

[0053] Example 3 Lyase catalytic active site verification

[0054] Glutamate (E) at positions 53 and 62 of the lyase (amino acid sequence shown in SEQ ID No. 1) was mutated to alanine (A) by site-directed mutagenesis experiments. The mutant plasmid was transformed and the protein was induced to express and purify according to the method described in Example 1 to obtain the lyase mutant protein His-zSUMO-Endolysin-eGFP (E53A, E62A). The SDS-PAGE results are as follows Figure 9 shown.

[0055] The antibacterial activity of the lyase mutant protein His-zSUMO-Endolysin-eGFP (E53A, E62A) was verified by Escherichia coli. The pre-mutated and post-mutated lyase proteins were added to the E. coli solution, and a blank control group was set up and incubated at 37 °C, and OD was measured every 1 h. 600 numerical value. At the same time, the bacteria treated with the protein were counted on the plate, and the difference in the activity of the protein before and after the mutation was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses klebsiella pneumoniae bacteriophage lyase with an amino acid sequence as shown in SEQ ID No.1. According to the klebsiella pneumoniae bacteriophage lyase disclosed by the invention, a lyase coding gene is cloned from klebsiella pneumoniae bacteriophage DP, and a prokaryotic expression mode is adopted to induce expression of dissolvable lyase; the obtained lyase recombinant protein can penetrate through an extracellular membrane of gram-negative bacteria under the condition of no outer membrane penetrating agent, hydrolyzes a peptidoglycan layer of a bacterial cell wall, shows strong bacteriostatic activity on gram-negative bacteria such as pseudomonas aeruginosa and escherichia coli, can be used for preparing drugs for resisting gram-negative bacteria, and can be used for preparing drugs for resisting gram-negative bacteria. Powerful support is provided for treating and inhibiting gram-negative bacterial diseases; in addition, the preparation method of the lyase is simple and suitable for industrial large-scale production.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and relates to a Klebsiella pneumoniae phage lyase, a preparation method thereof, and application in the preparation of medicines. Background technique [0002] Phage lyases are unique to double-stranded DNA bacteriophages, and are a class of cell wall hydrolases synthesized during the late stage of viral replication. It can reach the peptidoglycan target on the cell wall through the hole formed by perforin in the cell membrane, and cleave and hydrolyze the important chemical bonds in the peptidoglycan, eventually leading to bacterial lysis and death. Phage lyase can selectively and quickly kill specific bacteria, and it is not easy to develop resistance, and does not destroy the normal flora of the body. It is a "precise" antibacterial substance. [0003] The research on lyase for Gram-positive bacteria has made satisfactory progress, but the research on lyase for Gram-negative bacteria ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12N1/21A61K38/51A61P31/04C12R1/19
CPCC12N9/88C12N15/70A61P31/04A61K38/00Y02A50/30
Inventor杨虹林付志锋卢曙光
OwnerSOUTHWEST UNIV