Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Synthetase-1b for human cholesterol ester and coded sequence

A technology of cholesteryl ester and synthetase, which is applied in the direction of transferase, drug combination, peptide/protein composition, etc.

Inactive Publication Date: 2007-03-07
CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, no human ACAT1b and its coding sequence have been obtained

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Synthetase-1b for human cholesterol ester and coded sequence
  • Synthetase-1b for human cholesterol ester and coded sequence
  • Synthetase-1b for human cholesterol ester and coded sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] Example 1 Cloning and identification of human ACAT1b cDNA

[0076] In order to obtain the cDNA sequence containing human ACAT1b, design synthetic primers, the sequence is as follows:

[0077] L1D2BF: 5'ACCGCTCGAGTAGTTAAATAG3'

[0078] H1T7C1: 5'AGGTCTAGAACAGCTGGCTCCAAAT3'

[0079] Using L1D2BF and H1T7C1 primers, the ACAT1 cDNA K1 sequence was amplified by PCR, and the PCR product was cloned into the XhoI and XbaI sites of pcDNA3 (purchased from Invitrogen), and the sequence was determined correctly. On this basis, it was found that the cDNA sequence had the function of encoding 591 amino acids of human cholesteryl ester synthase, and the inventor named it the ACAT1b gene sequence.

[0080] The measured nucleotide sequence of human ACAT1b cDNA is shown in Figure 1 and SEQ ID NO:1.

Embodiment 2

[0081] Example 2 Analysis of human ACAT1b cDNA reading frame and its encoded amino acid sequence

[0082] According to the ACAT1b cDNA sequence obtained by sequencing and a series of sequence mutation studies, it was found that the 5'-region of the cDNA sequence has a non-AUG (GGC) translation initiation codon, and the 3'-region has a TAG translation termination codon, indicating that this It is a gene cDNA sequence with an atypical translation reading frame, which encodes a 591 amino acid sequence of human cholesteryl ester synthase ACAT1b (Figure 2), which is 41 more amino acid residue sequences than human ACAT1s reported by foreign counterparts.

Embodiment 3

[0083] Example 3 Construction of human ACAT1b cDNA eukaryotic expression vector

[0084] In order to determine the protein expression and enzyme activity analysis of human ACAT1b cDNA, the coding region of the human ACAT cDNA K1 sequence reported earlier was used as a positive control; then, the obtained positive control and sample cDNA were respectively inserted into pcDNA3 (purchased from Invitrogene Company) between XhoI and XbaI, located downstream of the CMV promoter, to obtain the corresponding eukaryotic expression vectors: pcDNA3-A1s and pcDNA3-A1b (see Figure 3A map). In order to separate from the ACAT1s protein, a mutation was introduced into the corresponding codon in the ACAT1b cDNA, which was also inserted between XhoI and XbaI of pcDNA3, located downstream of the CMV promoter, to obtain the corresponding eukaryotic expression vector: pcDNA3-A1bm, so that it only ACAT1b was expressed (see Figure 3B for expression profile).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A human cholesterol ester synthetase ACTA-1b, its coding sequence, the configurator containing said sequence, its carrier and its application in preparing the medicines for treating hypercholesterinema, atherosclerosis and senile dementia.

Description

technical field [0001] The invention relates to the technical fields of biochemistry, molecular biology, genetic engineering and DNA recombination. More specifically, it relates to human cholesteryl ester synthesis-1b (ACAT1b) and its coding sequence and their applications. Background technique [0002] Human cholesteryl ester synthase, namely human acyl-coenzyme A: cholesterol acyltransferase (ACAT, Acyl-coenzyme A: cholesterol acyltransferase, EC2.3.1.26), is the only enzyme in human cells that catalyzes the formation of cholesterol ester from long-chain fatty acids and free cholesterol . ACAT plays an important physiological function in the living body, mainly involved in the absorption, transportation and storage of cholesterol and its esters in the living body, and is one of the key enzymes to maintain the metabolic balance of cholesterol and its esters in the body. A large number of studies at home and abroad have shown that it synthesizes cholesteryl esters with hig...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/63C12N15/85C12N5/10C07K16/40A61K38/45A61P3/06
Inventor 李伯良张大元杨力何崇荛杨新颖陈佳陈江
Owner CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com