Method of identifying N-terminal proBNP
A sample, natural technology, applied in the field of recombinant N-terminal pro-BNP, antibody and their production, can solve the problem of no detection, etc., achieve good resolution, prolong the survival rate, and the effect of easy survival rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0051] Production method of recombinant N-terminal proBNP (1-76)
[0052] 1. Cloning of recombinant N-terminal proBNP
[0053] The nucleotide sequence of N-terminal proBNP (amino acid sequence 1-76) was produced by means of genetic synthesis. For optimal expression of the gene in E. coli, the sequence was adapted to the most commonly used codons in E. coli. The oligonucleotide sequence used to generate the gene is as follows:
[0054] Pro5' (SEQ ID NO 1).
[0055] 5'CCGGATCCCACCCGCTG3'
[0056] Pro1hum (SEQ ID NO 2):
[0057] 5'CGGGATCCCACCCGCTGGGTTCCCCGGGTTCCGCTTCCGACCTGGAAACCT
[0058] CCGGTCTGCAGGAACAGCGTAACCACCT3'
[0059]Pro2hum (SEQ ID NO 3).
[0060] 5'CGGTTCCAGGGAGGTCTGTTCAACCTGCAGTTCGGACAGTTTACCCTGCAG
[0061] GTGGTTACGCTGTTCCTGC3'
[0062] Pro3hum (SEQ ID NO 4)
[0063] 5′CAGACCTCCCCTGGAACCGCTGCAGGAATCCCCGCGTCCGACCGGTGTTTGG
[0064] AAATCCCGTGAAGTTGCTAC3'
[0065] Pro4hum (SEQ ID NO 5):
[0066] 5′CCCAAGCTTAACGCGGAGCACGCAGGGTGTACAGAACCATTTTACGGTGA
[...
Embodiment 2
[0074] Production of polyclonal antibodies against N-terminal proBNP
[0075] 1. Immunization
[0076] Sheep were immunized with recombinant N-terminal proBNP(1-76) in complete Freund's adjuvant. The dose was 0.1 mg per animal. Immunizations were repeated at 4-week intervals over a period of 10 months. Starting 6 weeks after the first immunization, serum was taken monthly and its sensitivity and titer determined.
[0077] 2. Purification of Polyclonal Antibody from Sheep Serum
[0078] Starting from the crude serum of sheep immunized with N-terminal proBNP, the lipid components were removed by a delipidation process performed in aerosol. Immunoglobulins were then isolated with ammonium sulfate (2M). 15 mM KPO at pH 7.0 4 , 50 mM NaCl and the dissolved precipitate was dialyzed and subjected to DEAE sepharose chromatography. In the IgG fraction, PAKS-IgG(DE) was present in the eluted fraction.
[0079] 3. Sequential affinity chromatography for the generation of NT...
Embodiment 3
[0088] Production and detection of monoclonal antibody against N-terminal proBNP(1-76)
[0089] 1. Obtain monoclonal antibody against NT-proBNP(1-76)
[0090] 8-12 week old Balb / c mice were administered intraperitoneally with 100 μg of recombinant N-terminal proBNP antigen with Freund's adjuvant for immunization. After 6 weeks, 3 further immunizations were performed at 4 week intervals. Blood was drawn one week after the last immunization and the antibody titers in the sera of the test animals were determined. B-lymphocytes were obtained from the spleens of positive responding mice and fused with immortalized myeloma. The fusion is performed according to the known method of Köhler and Millstein (Nature 256, 1975, p. 495-497). Primary cultures of hybrid cells constructed here are cloned by common means, for example, by use of commercially available cell sorters or by "limiting dilution". Only those clones, which react positively with recombinant N-terminal proBNP and rec...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap