Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method of identifying N-terminal proBNP

A sample, natural technology, applied in the field of recombinant N-terminal pro-BNP, antibody and their production, can solve the problem of no detection, etc., achieve good resolution, prolong the survival rate, and the effect of easy survival rate

Inactive Publication Date: 2007-07-18
ROCHE DIAGNOSTICS GMBH
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] Therefore, there is no method in the art for the detection of N-terminal proBNP that enables reliable and sensitive detection of native N-terminal proBNP during short incubation periods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Production method of recombinant N-terminal proBNP (1-76)

[0052] 1. Cloning of recombinant N-terminal proBNP

[0053] The nucleotide sequence of N-terminal proBNP (amino acid sequence 1-76) was produced by means of genetic synthesis. For optimal expression of the gene in E. coli, the sequence was adapted to the most commonly used codons in E. coli. The oligonucleotide sequence used to generate the gene is as follows:

[0054] Pro5' (SEQ ID NO 1).

[0055] 5'CCGGATCCCACCCGCTG3'

[0056] Pro1hum (SEQ ID NO 2):

[0057] 5'CGGGATCCCACCCGCTGGGTTCCCCGGGTTCCGCTTCCGACCTGGAAACCT

[0058] CCGGTCTGCAGGAACAGCGTAACCACCT3'

[0059]Pro2hum (SEQ ID NO 3).

[0060] 5'CGGTTCCAGGGAGGTCTGTTCAACCTGCAGTTCGGACAGTTTACCCTGCAG

[0061] GTGGTTACGCTGTTCCTGC3'

[0062] Pro3hum (SEQ ID NO 4)

[0063] 5′CAGACCTCCCCTGGAACCGCTGCAGGAATCCCCGCGTCCGACCGGTGTTTGG

[0064] AAATCCCGTGAAGTTGCTAC3'

[0065] Pro4hum (SEQ ID NO 5):

[0066] 5′CCCAAGCTTAACGCGGAGCACGCAGGGTGTACAGAACCATTTTACGGTGA

[...

Embodiment 2

[0074] Production of polyclonal antibodies against N-terminal proBNP

[0075] 1. Immunization

[0076] Sheep were immunized with recombinant N-terminal proBNP(1-76) in complete Freund's adjuvant. The dose was 0.1 mg per animal. Immunizations were repeated at 4-week intervals over a period of 10 months. Starting 6 weeks after the first immunization, serum was taken monthly and its sensitivity and titer determined.

[0077] 2. Purification of Polyclonal Antibody from Sheep Serum

[0078] Starting from the crude serum of sheep immunized with N-terminal proBNP, the lipid components were removed by a delipidation process performed in aerosol. Immunoglobulins were then isolated with ammonium sulfate (2M). 15 mM KPO at pH 7.0 4 , 50 mM NaCl and the dissolved precipitate was dialyzed and subjected to DEAE sepharose chromatography. In the IgG fraction, PAKS-IgG(DE) was present in the eluted fraction.

[0079] 3. Sequential affinity chromatography for the generation of NT...

Embodiment 3

[0088] Production and detection of monoclonal antibody against N-terminal proBNP(1-76)

[0089] 1. Obtain monoclonal antibody against NT-proBNP(1-76)

[0090] 8-12 week old Balb / c mice were administered intraperitoneally with 100 μg of recombinant N-terminal proBNP antigen with Freund's adjuvant for immunization. After 6 weeks, 3 further immunizations were performed at 4 week intervals. Blood was drawn one week after the last immunization and the antibody titers in the sera of the test animals were determined. B-lymphocytes were obtained from the spleens of positive responding mice and fused with immortalized myeloma. The fusion is performed according to the known method of Köhler and Millstein (Nature 256, 1975, p. 495-497). Primary cultures of hybrid cells constructed here are cloned by common means, for example, by use of commercially available cell sorters or by "limiting dilution". Only those clones, which react positively with recombinant N-terminal proBNP and rec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A new method to detect N-terminal pro-brain natriuretic peptide (BNP) in a sample is characterized in that at least two antibodies, that recognize different epitopes of the N-terminal pro-BNP, are used. Independent claims are also included for the following: (1) recombinant N-terminal pro-BNP; (2) an antibody against recombinant N-terminal pro-BNP; (3) cell lines M10.1.11 or M13.4.14 deposited on the 26.01.1999 at the DSMZ (undefined); and (4) methods to produce polyclonal or monoclonal antibodies of (2).

Description

technical field [0001] The present invention relates to a method for identifying N-terminal proBNP (N-terminalem proBNP) in a sample by means of at least two antibodies that detect different epitopes of N-terminal proBNP. This method was used to differentiate or classify samples from healthy individuals and NYHA class I to IV patients. The present invention further relates to recombinant N-terminal proBNP, the use of said N-terminal proBNP as a standard in a method for identifying N-terminal proBNP, for detecting antibodies to recombinant N-terminal proBNP and their production. Background technique [0002] Heart failure is a widespread phenomenon, especially in the Western world. According to Roche's Medical Dictionary (1993, Urban & Schwarzenberg), heart failure is the acute or chronic decline (degenerative or progressive failure). Therefore, the pumping function of the heart is fragile. The causes of heart failure are complex. Among other causes, inflammation and deg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/68C07K14/58C07K16/26C07K16/18C12N15/06G01N33/53C07K14/575C12N5/10C12N15/02C12N15/09C12P21/08C12R1/91G01N
CPCC07K2317/34C07K16/26G01N33/6887G01N33/68
Inventor J·卡尔H·利尔P·斯塔尔K·克吕格尔A·博格亚A·加卢塞尔
Owner ROCHE DIAGNOSTICS GMBH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com